Key points are not available for this paper at this time.
NEDD8 is a ubiquitin-like molecule that can be covalently conjugated to a limited number of cellular proteins, such as Cdc53/cullin. We have previously reported that the C terminus of NEDD8 is efficiently processed to expose Gly-76, which is required for conjugation to target proteins. A combination of data base searches and polymerase chain reaction cloning was used to identify a cDNA encoding human UBA3, which is 38% identical to the yeast homologue, 22% identical to human UBA2, and 19% identical to the C-terminal region of human UBE1. The human UBA3 gene is located on chromosome 3p13 and gave rise to a 2.2-kilobase pair transcript that was detected in all tissues. Human UBA3 could be precipitated with glutathione S-transferase (GST)-NEDD8, but not with GST-ubiquitin or GST-sentrin-1. Moreover, human UBA3 could form a β-mercaptoethanol-sensitive conjugate with NEDD8 in the presence of APP-BP1, a protein with sequence homology to the N-terminal half of ubiquitin-activating enzyme. We have also cloned human UBC12 and demonstrated that it could form a thiol ester linkage with NEDD8 in the presence of the activating enzyme complex. Identification of the activating and conjugating enzymes of the NEDD8 conjugation pathway should allow for a more detailed study of the role of NEDD8 modification in health and disease. NEDD8 is a ubiquitin-like molecule that can be covalently conjugated to a limited number of cellular proteins, such as Cdc53/cullin. We have previously reported that the C terminus of NEDD8 is efficiently processed to expose Gly-76, which is required for conjugation to target proteins. A combination of data base searches and polymerase chain reaction cloning was used to identify a cDNA encoding human UBA3, which is 38% identical to the yeast homologue, 22% identical to human UBA2, and 19% identical to the C-terminal region of human UBE1. The human UBA3 gene is located on chromosome 3p13 and gave rise to a 2.2-kilobase pair transcript that was detected in all tissues. Human UBA3 could be precipitated with glutathione S-transferase (GST)-NEDD8, but not with GST-ubiquitin or GST-sentrin-1. Moreover, human UBA3 could form a β-mercaptoethanol-sensitive conjugate with NEDD8 in the presence of APP-BP1, a protein with sequence homology to the N-terminal half of ubiquitin-activating enzyme. We have also cloned human UBC12 and demonstrated that it could form a thiol ester linkage with NEDD8 in the presence of the activating enzyme complex. Identification of the activating and conjugating enzymes of the NEDD8 conjugation pathway should allow for a more detailed study of the role of NEDD8 modification in health and disease. ubiquitin-activating enzyme ubiquitin-conjugating enzyme polymerase chain reaction kilobase pair(s) expressed sequence tag tentative human consensus NEDD8 is a novel 81-amino acid polypeptide that is 60% identical and 80% homologous to ubiquitin (1Kumar S. Yoshida Y. Noda M. Biochem. Biophys. Res. Comm. 1993; 195: 393-399Crossref PubMed Scopus (114) Google Scholar). Antiserum specific for NEDD8 detected a 6-kDa NEDD8 monomer and a series of NEDD8 multimers or NEDD8-conjugated proteins (2Kamitani T. Kito K. Nguyen H.P. Yeh E.T.H. J. Biol. Chem. 1997; 272: 28557-28562Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar). However, in all cell lines tested, the conjugation pattern of NEDD8 is entirely different from that of ubiquitin (2Kamitani T. Kito K. Nguyen H.P. Yeh E.T.H. J. Biol. Chem. 1997; 272: 28557-28562Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar). Immunocytochemical analysis showed that NEDD8-conjugated proteins were highly enriched in the nucleus. In contrast, ubiquitin-conjugated proteins were detected equally well in the nucleus and cytosol. Mutational analysis showed that the C terminus of NEDD8 was efficiently cleaved and that Gly-76 was required for conjugation of NEDD8 to other proteins. The yeast homologue of NEDD8, Rub1, can also be conjugated to a limited number of cellular proteins, including Cdc53/cullin, a component of the SCF ubiquitin ligase (a complex composed of Cdc53, Skp1, and an F-box protein) that plays a critical role in the regulation of cell cycle progression (3Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (278) Google Scholar, 4Liakopoulos D. Doenges G. Matuschewski K. Jentsch S. EMBO J. 1998; 17: 2208-2214Crossref PubMed Scopus (306) Google Scholar). A prominent 90-kDa NEDD8-modified protein was detected in all mammalian cells, which was consistent with the molecular mass of the NEDD8-cullin-1 conjugate (2Kamitani T. Kito K. Nguyen H.P. Yeh E.T.H. J. Biol. Chem. 1997; 272: 28557-28562Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar). The substrate specificity of NEDD8 conjugation appears to be strictly regulated because NEDD8 cannot conjugate to PML and RanGAP1, two substrates of the sentrin family of ubiquitin-like proteins (2Kamitani T. Kito K. Nguyen H.P. Yeh E.T.H. J. Biol. Chem. 1997; 272: 28557-28562Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar, 5Kamitani T. Nguyen H.P. Kito K. Fukuda-Kamitani T. Yeh E.T.H. J. Biol. Chem. 1998; 273: 3117-3120Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar). The function of NEDD8 modification is not known at present. Yeast mutants defective in Rub1 are viable, but sensitive to alterations in the levels of Cdc4, Cdc34, and Cdc53 (3Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (278) Google Scholar). It is not known whether NEDD8 conjugation is also involved in targeting proteins to the proteasome. Ubiquitin-mediated proteolysis is an important pathway of non-lysosomal protein degradation. This pathway involves a cascade of enzymatic reactions (6Hershko A. Ciechanover A. Annu. Rev. Biochem. 1992; 61: 761-807Crossref PubMed Scopus (1197) Google Scholar). The first step is the ATP-dependent activation of ubiquitin by a ubiquitin-activating enzyme (E1),1 leading to the formation of a thiol ester linkage between Gly-76 of ubiquitin and a cysteine residue of E1. In the second step, activated ubiquitin is transferred to a cysteine residue in one of several ubiquitin-conjugating enzymes (E2) to form another thiol ester conjugate. In the last step, an isopeptide bond is formed between Gly-76 of ubiquitin and a lysyl ε-amino group within a substrate protein, a reaction catalyzed either directly by the E2 enzyme or via a third enzyme designated ubiquitin-protein ligase. A single E1 enzyme has been characterized from human, mouse, wheat, andSaccharomyces cerevisiae (7Handley-Gearhart P.M. Stephen A.G. Trausch-Azar J.S. Ciechanover A. Schwartz A.L. J. Biol. Chem. 1994; 269: 33171-33178Abstract Full Text PDF PubMed Google Scholar). In yeast, Uba1 is essential for viability and encodes a 114-kDa activating enzyme required for ubiquitin conjugation (8McGrath J.P. Jentsch S. Varshavsky A. EMBO J. 1991; 10: 227-236Crossref PubMed Scopus (188) Google Scholar). Another E1-like protein, Uba2, which encodes a 71-kDa protein that is similar to the C terminus of E1 proteins and bears a cysteine residue at a position similar to the active-site cysteine of Uba1, has been identified (9Dohmen R.J. Stappen R. McGrath J.P. Forrov H. Kolarov J. Goffeau A. Varshavsky A. J. Biol. Chem. 1995; 270: 18099-18109Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Johnson et al.(10Johnson E.S. Schwienhorst I. Dohmen R.J. Blobel G. EMBO J. 1997; 16: 5509-5519Crossref PubMed Scopus (441) Google Scholar) demonstrated that Uba2 cooperates with another 40-kDa protein, termed Aos1 (activation of Smt3), the yeast homologue of the sentrin family of ubiquitin-like proteins (11Okura T. Gong L. Kamitani T. Wada T. Okura I. Wei C.K. Chang H.M. Yeh E.T.H. J. Immunol. 1996; 157: 4277-4281PubMed Google Scholar). Interestingly, both human and yeast Aos1 and Uba2 share extensive homology with the N- and C-terminal halves of yeast ubiquitin-activating enzyme, Uba1. 2L. Gong and E. T. H. Yeh, manuscript in preparation. 2L. Gong and E. T. H. Yeh, manuscript in preparation. In this paper, we report the molecular cloning of a human cDNA encoding a protein homologous to yeast Uba3, which has recently been shown to be involved in the activation of Rub1 (3Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (278) Google Scholar, 4Liakopoulos D. Doenges G. Matuschewski K. Jentsch S. EMBO J. 1998; 17: 2208-2214Crossref PubMed Scopus (306) Google Scholar). We show that UBA3 is homologous to the C-terminal half of E1 and can form a thiol ester conjugate with NEDD8 in the presence of APP-BP1, which is homologous to the N-terminal half of E1. Furthermore, we have cloned human UBC12 and demonstrate that it could form a thiol ester linkage with NEDD8 in the presence of APP-BP1 and UBA3. The identification of the specific E1 complex and E2 for NEDD8 should provide further stimuli to study the role of NEDD8 modifications in health and disease. All chemical reagents were purchased from Sigma unless otherwise noted. DNA restriction endonucleases and T4 ligase were from New England Biolabs Inc. (Beverly, MA) or Roche Molecular Biochemicals. Human and mouse cDNA libraries, multiple-tissue Northern blots, and the PCR amplification kit were obtained fromCLONTECH (Palo Alto, CA). The TNT®T7-coupled reticulocyte lysate system was purchased from Promega (Madison, WI). ATP, α-32PdCTP,l-35Smethionine, Hyperfilm MP, and the GST protein purification kit were from Amersham Pharmacia Biotech. Prestained molecular mass markers and SDS-polyacrylamide gel electrophoresis reagents were obtained from Bio-Rad. Oligonucleotides were synthesized with a Beckman DNA synthesizer (Model olig1000M). The sequences of the primers used in this study are as follows: olig1, CTGGATCCAAATGGCTGTTGATGGTGGG; olig2, GGAATTCTTATGCATATTGGCCTCTATGG; olig3, CTGGAGAGATTCAGTGCTCGGTTCGA; olig4, TATCTATTCGATGATGAAGATACC; olig5, CAGACTGTACTATTCAAACTTCATTTT; olig6, TGCACAGTTAAGTGAACTTGCGG; olig7, AGGATGATCAAGCTGTTCTCGCTGAAG; and olig8, GCAGTAACATTCCCCTTTAGTTAGCC. Escherichia colistrains XL1-Blue and BL21 were used for cDNA cloning and expression of GST fusion proteins, respectively. All plasmid constructs were made using standard techniques. Each construct was sequenced to verify the correct frame as well as the proper sequence of any linker introduced during the cloning procedure. The plasmids used as templates for in vitro translation were constructed based on the vector pcDNA3. A 1.3-kb cDNA containing the entire coding sequence of UBA3 was amplified from a human placenta cDNA library by PCR using an oligonucleotide forward primer (5′-GCGAAGCTTAAATGGCTGTTGATGGTGGG-3′) containing aHindIII site (underlined) and a reverse primer (5′-GCGGGTACCAAGAAGTAAAATGAAGTTTG-3′) containing aKpnI site (underlined). The PCR product was digested withHindIII and KpnI and ligated with the 5.4-kbHindIII-KpnI fragment from a derivative of pcDNA3 to construct pcDNA3-UBA3. pcDNA3-APP-BP1 and pcDNA3-UBC12 were constructed in a similar way, except that the 1.6-kb HindIII-KpnI fragment ofAPP-BP1 and the 0.55-kb HindIII-KpnI fragment of UBC12 were used. For the generation of the GST fusion plasmid, a DNA segment encoding the first 76 amino acids of NEDD8 was amplified by PCR using a 5′-primer (5′-GGCGAATTCATGCTGATTAAAGTGAAGACGCTG-3′) containing anEcoRI site (underlined) and a 3′-primer (5′-ATTGTCGACTCATCCTCCTCTCAGAGCCAAC-3′) containing anXhoI site (underlined). The PCR product was cut withEcoRI and XhoI and ligated with pGEX-5X1 previously linearized with EcoRI and XhoI to construct pGEX-NEDD8. pGEX-UB and pGEX-sentrin-1 were constructed in a similar way, except that the 0.23-kb EcoRI-XhoI fragment of ubiquitin and the 0.30-kb EcoRI-XhoI fragment of sentrin-1 covering the first 97 residues were used. To clone the activating enzyme of NEDD8, we first performed a TBLASTN search of the Tentative Human Consensus Sequence data base generated by the Institute for Genomic Research using the partial amino acid sequence of human UBE1 (amino acids 450–500) that contains the ATP-binding region. This identified 17 positive THC fragments. After further analysis, two THC fragments (THC197270 and THC206278) were found to have highly conserved ATP-binding but different from was found to be more to yeast Uba2, which in the of an activating enzyme for extensive search of the Tentative Human Consensus Sequence data base using the sequence of another THC fragment that with We and synthesized two and to the from both the as we obtained a 1.3-kb PCR fragment from both human placenta and cDNA Sequence data of the PCR from two different cDNA showed that are amplification of cDNA was performed to the cDNA sequence the and from the sequence of the 1.3-kb PCR product was used as the primer in combination with a primer of The PCR product obtained a region from the vector the of the 1.3-kb The PCR product of was To identify the of the a second PCR was performed using as the primer with The product was a pair of and with the sequence in the and we amplified a cDNA fragment from the human placenta cDNA library by For identification of mouse UBA3, the amino acid sequence of human UBA3 was used to search the mouse data base of expressed sequence For identification of the partial amino acid sequence from human was used to search the Tentative Human Consensus Sequence data positive THC fragment was identified and used for the otherwise PCR was in a of containing of and of which on a Research The reaction was at for and the amplification reaction of of and with a at for For amplification of cDNA primers specific to human UBA3 cDNA and primers were used in the and A of for for and for and human placenta or cDNA as a were used in the A of for and for and of the PCR product as a were used in the The DNA sequences of the identified were on both using DNA reagents and an To the of the human UBA3 human DNA was digested with either and with a for UBA3. To study the expression pattern of the UBA3 a Northern containing from different was used. The coding human placenta cDNA for UBA3 was amplified by PCR and and using a kit to the A human was used as a to The cDNA was with using the DNA system and was by on a CA). The was for at in and and DNA and for at in was performed with the The was with and at for and with and at for were obtained by the to with an at for The plasmids and pGEX-sentrin-1 were used for expression of GST fusion proteins. The expression were introduced BL21 and expression of GST fusion proteins was by and as previously L. Kamitani T. K. Yeh E.T.H. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar). For in vitro translation of UBA3, APP-BP1, and UBC12 proteins, and pcDNA3-UBC12 were used as templates for in vitro and translation using polymerase by the reactions were performed in reticulocyte in a of of of of amino acid and of The reactions were for at and by the of of were by SDS-polyacrylamide gel were in Pharmacia and processed for For in vitro between NEDD8 and UBA3, of in vitro UBA3 with or of APP-BP1 were with of containing of or for at For thiol ester bond formation between NEDD8 and of in UBA3 and APP-BP1 and of UBC12 were with of containing GST fusion protein for at A cDNA sequence encoding a protein with homology to the human E1 protein was identified by a combination of data base searches and PCR amplification The and amino acid sequences of one of the cloned human are shown in The amino acid sequence of the cloned human cDNA is similar to yeast and similar to yeast Uba2 and the C-terminal half of the E1 enzyme We this protein UBA3 because of to yeast and to form a thiol ester bond with NEDD8 The contains an frame with an and with a The is by an at and it is the for the Another is located at but the UBA3 was found to from the first The pair region has a the of the two are is at and is located at This frame encodes a protein of amino acids The molecular mass and based on the amino acid sequence of human UBA3, are and respectively. with the amino acid sequence for yeast Uba3, human UBA3 has an amino acids at terminus and an amino acids at C terminus of human, yeast, and mouse UBA3. acids that are identical to the position in yeast human and mouse are The to the sequence of important are in the known E1 one is the consensus sequence for a (amino acids in human and the other is the consensus sequence the essential cysteine in E1 enzymes (amino acids in human which to ubiquitin in an thiol ester shown in both and UBA3 have an identical ATP-binding region and a conserved active-site The last amino acid residue in the active-site of yeast and human E1 is In contrast, the last amino acid residue in the active-site of yeast and human is it is for yeast and human UBA3. be required to whether this to the substrate for different activating analysis of human DNA digested with either using a for UBA3 the presence of a single not This the of one of the Northern analysis a single in all but the of in the and and in the the human UBA3 cDNA sequence was used to search the data base using the positive were All of were used to the Human data of have been to chromosome between and markers at for gene is located on chromosome The E1-like is also located on chromosome is located on chromosome and is located on chromosome We also the mouse data base to identify mouse UBA3. A number of positive such as (amino acids (amino acids (amino acids (amino acids and (amino acids have been an was made to the mouse gene by using primers were from and This to the of a cDNA from a mouse cDNA The frame encodes a protein of amino acids with a molecular mass of and a of with the human UBA3 the mouse UBA3 sequence is one amino acid at the C sequence between mouse and human UBA3, using with showed between the two The of between the two proteins is Interestingly, both human and mouse UBA3 identical N- and C-terminal amino which are from yeast The of N- and C-terminal further UBA3 has a conserved ATP-binding site and an site of we whether UBA3 be to form a thiol ester linkage with either ubiquitin or ubiquitin-like proteins. shown in A in vitro UBA3 in two and This is to of the two and in The in vitro UBA3 was with GST-ubiquitin or at for in the presence of The GST were and the precipitated proteins were by SDS-polyacrylamide gel two and could be precipitated by but not by GST-ubiquitin or GST-sentrin-1. UBA3 appears to to However, a molecular mass conjugate could not be detected UBA3 is homologous to the C-terminal half of it is that another protein homologous to the N-terminal half of E1 is required for the formation of a conjugate. we whether human be to UBA3 in the formation of the conjugate. However, human could not UBA3 and to be specific for the we an homologue, APP-BP1, for to UBA3 in the formation of the conjugate. APP-BP1 was identified in a yeast cloning as a protein for the protein N. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). In vitro APP-BP1 in a single of In vitro UBA3 and APP-BP1 were with GST-ubiquitin and and by SDS-polyacrylamide gel A molecular mass of consistent with the molecular mass of was in the This cannot be a conjugate because APP-BP1 not the active-site Furthermore, the UBA3 which contains a in the could not form a conjugate The thiol ester bond formation between UBA3 and NEDD8 was on the presence of we showed that the was sensitive to that it a thiol ester conjugate that formation of a conjugate is on the presence of are also consistent with that Rub1, the yeast homologue of NEDD8, can form a thiol ester bond with yeast (3Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (278) Google Scholar, 4Liakopoulos D. Doenges G. Matuschewski K. Jentsch S. EMBO J. 1998; 17: 2208-2214Crossref PubMed Scopus (306) Google Scholar). Moreover, the yeast homologue of APP-BP1, is also required for the activation of is a in the in the activation of NEDD8 and conjugate is sensitive to The position of the conjugate formed in the presence of APP-BP1 is was was with We have previously identified as a specific conjugating enzyme in the pathway L. Kamitani T. K. Yeh E.T.H. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar). the specificity of the conjugating enzymes in the we used NEDD8 as a and to a thiol ester bond formation between NEDD8 and known human E2 proteins, including and not we to identify human E2 proteins that could conjugate to We used the amino acid sequence from the conjugation site of human as a to search the Tentative Human Consensus Sequence data positive THC fragments were After further analysis, one THC fragment was found to have a conserved sequence different from known E2 proteins. We two and to the from PCR amplification from a human placenta cDNA library in the of a pair The sequences and amino acids are shown in A. The cloned cDNA contains an frame with an and with a The cloned cDNA encodes a protein of amino acid residues that is identical and similar to the yeast protein human and yeast proteins have an identical the cysteine residue (a site for the formation of a thiol ester which that the cloned human cDNA is not another This was also found in mouse and by analysis of from data the of human UBC12 to form thiol ester with NEDD8, or sentrin-1 was shown in but not GST-ubiquitin or could in vitro However, we could not an NEDD8 and UBC12 conjugate in the of E1 APP-BP1 and UBA3 were to the reaction a conjugate could be detected This conjugated to UBC12 via a thiol ester linkage because it the was with UBC12 is the E2 that was to form a conjugate with This is also consistent with the report of the critical role of yeast in the conjugation of Rub1 D. Doenges G. Matuschewski K. Jentsch S. EMBO J. 1998; 17: 2208-2214Crossref PubMed Scopus (306) Google Scholar). has to be one of the protein modification and plays a critical role in cellular A.L. J. 1997; PubMed Scopus Google Scholar, A. EMBO J. 1998; 17: PubMed Scopus Google Scholar, Rev. 1995; PubMed Scopus Google Scholar). The of the system is further by the identification of other ubiquitin-like such as and is a protein that contains two ubiquitin A.L. P.M. H. J. Biol. Chem. Full Text PDF PubMed Google Scholar). has been shown to conjugate to a number of proteins A.L. J. Biol. Chem. 1992; Full Text PDF PubMed Google Scholar). by have not been from the J. A.L. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar) that conjugation an enzyme pathway from that of at with to the activation However, the of the activating enzyme for is not The sentrin family of ubiquitin-like proteins of family that have similar substrate We have shown that and are to conjugate to and PML T. Nguyen H.P. Kito K. Fukuda-Kamitani T. Yeh E.T.H. J. Biol. Chem. 1998; 273: 3117-3120Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar). The yeast homologue of sentrin is which an activating enzyme complex of Uba2 and Aos1 E.S. Schwienhorst I. Dohmen R.J. Blobel G. EMBO J. 1997; 16: 5509-5519Crossref PubMed Scopus (441) Google Scholar). A similar complex is also required for the activation of the sentrin family both sentrin and as the conjugating enzyme E.S. Schwienhorst I. Dohmen R.J. Blobel G. EMBO J. 1997; 16: 5509-5519Crossref PubMed Scopus (441) Google Scholar, L. Kamitani T. K. Yeh E.T.H. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar). We have shown previously that NEDD8 can be covalently conjugated to a limited number of cellular proteins (2Kamitani T. Kito K. Nguyen H.P. Yeh E.T.H. J. Biol. Chem. 1997; 272: 28557-28562Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar). In this we cloned and characterized both the activating and conjugating enzyme for are consistent with from the yeast system (3Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (278) Google Scholar, 4Liakopoulos D. Doenges G. Matuschewski K. Jentsch S. EMBO J. 1998; 17: 2208-2214Crossref PubMed Scopus (306) Google Scholar). the enzymatic for the activation and conjugation of ubiquitin-like proteins from the system in We T. Kamitani for and and L. S. for
Gong et al. (Thu,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: