First report of Grapevine rupestris stem pitting-associated virus, Grapevine virus B, Grapevine Syrah virus-1, and Grapevine Red Globe virus infecting grapevine in Peru

Grapevine (Vitis vinifera) is an economically significant crop in Peru, primarily cultivated along the coastal regions by large agro-export farms. Despite its importance, limited information is available on the occurrence of viruses affecting grapevine in the country. Between May and November 2023, 106 symptomatic grapevine leaf samples were collected from Piura (27), Ica (44), La Libertad (9), and Lambayeque (26). Leaf symptoms included mosaic patterns, chlorotic spots, and vein clearing. Total RNA was extracted using a modified CTAB method and these 106 samples were individually subjected to small RNA sequencing on the Illumina NovaSeq 6000 S4 SE50 platform, generating reads of approximately 50 nucleotides in length. Bioinformatics analysis was performed using the VirusDetect pipeline (Zheng et al., 2017). After trimming the adaptor sequences and the reads with low quality, as well as the host-sequence depletion, we obtained between 16,248,980 and 19,832,006 clean reads per sample. Next, the same pipeline, using BWA 0.7.10 and Velvet v1.1.07, assembled the clean reads into contigs. Finally, BLASTn was used to identify potential viral sequences. The results obtained with VirusDetect were manually validated with Geneious Prime 2025.1.2 and Bowtie. The analysis revealed the presence of five viruses from two families: Betaflexiviridae (Grapevine rupestris stem pitting-associated virus, GRSPaV – Foveavirus; Grapevine virus B, GVB – Vitivirus and Grapevine Pinot gris virus, GPGV – Trichovirus), and Tymoviridae (Grapevine Syrah virus-1, GSyV-1 – Marafivirus; and Grapevine Red Globe virus, GRGV – Maculavirus). These findings confirmed the presence of GPGV, which was recently reported in Peru (Sanchez-Moncada and Álvarez, 2025) wth 96.67% nucleotide sequence identity with Peruvian isolate MC2 (Genbank accession number PQ461689.1). Further analysis of only individual samples (TI53, TC105, TP7, TC108 and TC109) identified the viruses based on contig mapping to reference genome with identity over 93%. Nearly complete genomes were recovered using small RNA sequencing approach. The presence of these viruses, initially detected by high-throughput sequencing, was subsequently confirmed by RT-PCR using specific primers targeting the RNA dependent RNA polymerase (RDRP), coat protein (CP), RNA-Binding Protein (RBP) or Movement protein (MP) regions in the large RNA fraction of the same samples GRSPaV (GrSPaV-CP-F: GAGGTGTTGGGCGGTCTGAAGG, GrSPaV-CP-R: CCAGCGAACAGGCTTAACCCAGC): GVB (H28: GTGCTAAGAACGTCTTCACAGC, C410: ATCAGCAAACACGCTTGAACCG), GPGV ()GPGV-RdRp-F: TGCAGATACATGGAAAAGGTTTTCAGC, GPGV-RdRp-R: CAATTTCATTCCTCTCCAGTAAAATTCCG), GSyV-1 (GSyV-1-Det-F: CAAGCCATCCGTGCATCTGG, GSyV-1-Det-R: GCCGATTTGGAACCCGATGG), GRGV (GRGV-CF-F1: GAATTCGCTGTCGGCCACTC, GRGV-CF-R1: AGTGAGAGGAGAGATTCCATC). Sanger sequencing of the amplicons further validated the presence of all five viruses but only in 5 samples. The viral amplicon sequences have been submitted to GenBank (PV806510 to PV806515 and PV872011 to PV872016). Comparative sequence analysis revealed a high similarity between Peruvian viral strains and those from other regions, suggesting potential introduction through plant material lacking proper indexing. These viruses are important because, in the genera Vitivirus or Foveavirus are reported as putative agents of the individual disease of the rugose wood complex, where in certain cultivars, the bark above the graft union is exceedingly thick and corky. GPGV shows symptoms of chlorotic mottling and leaf deformations; however, GRGV and GSyV-1 have not yet been associated with any syndrome, but these two last viruses are phloem limited, and primarily spread through infected propagating material. Because all the samples analyzed were coinfected (Table S1), no relationship between the virus and the symptoms could be made. In our study the number of samples infected with these viruses confirmed by NGS and RT-PCR were: GPGV was found in 8/106; GSyV-1, in 6/106; GVB, in 4/106; GRGV, in 2/106; and finally, GRSPaV was found by NGS in 24/106 samples and validated by RT-PCR in 2/106. To our knowledge, this is the first report of GRSPaV, GVB, GSyV-1, and GRGV infecting grapevine in Peru, in addition to confirming the presence of GPGV. These findings highlight the need for virus monitoring and management strategies to mitigate potential threats to grape production and warrant further investigation into their prevalence and economic impact.