First Report of Telosma mosaic virus Infecting Passiflora foetida in Taiwan

Passion fruit (Passiflora edulis) is a perennial vine belonging to the Passiflora genus in the family Passifloraceae. Viral diseases are a major threat for passion fruit production. In Taiwan, the annual replanting of virus-free seedlings has been practiced for more than 35 years, which has contributed to stable passion fruit yields. More than 40 viruses from 13 genera have been reported to infect passion fruit (Wu et al. 2024). Among them, Telosma mosaic virus (TelMV), a member of genus Potyvirus (family Potyviridae), is a known pathogen associated with fruit woodiness disease in passion fruit across Asia (Zhang et al. 2024; Wu et al. 2024). Natural infection of wild Passiflora species by TelMV has not been previously reported. In September 2024, wild plants of P. foetida exhibiting mottle and mosaic symptoms were observed near commercial passion fruit orchards in Puli, Nantou County, Taiwan. Tissue sap extracted from the symptomatic leaves was mechanically inoculated onto leaves of Chenopodium quinoa, resulting in the development of local lesions. These single lesions were then back-inoculated onto healthy seedlings of P. foetida and yellow passion fruit, both of which subsequently developed mosaic symptoms. RT-PCR analysis of the symptomatic P. foetida leaves using a TelMV-specific primer pair TelMV-12u (5' GGATGCCCGGATGGATGAACTA3')/Oligo-dT(14) yielded a predicted~1.2 kb nucleic acid fragment, which sequencing confirmed to correspond to the 3'-terminal region of TelMV and closely relative to TelMV-LS30 (GenBank Accession no. MH500103; collected from P. edulis, Taiwan). Furthermore, using TelMV-specific primers (TwTe650u 5'GTTGAGCAACTCAAAAATC 3'/TwTe650d 5'TTTTATTTGTAGTGCCAAC 3'), a ~650 bp TelMV-specific fragment was amplified from the original P. foetida samples, the C. quinoa lesion tissues, the symptomatic P. foetida and yellow passion fruit leaves after inoculation. These results, confirmed by Koch’s postulates, nucleotide sequencing, and RT-PCR detection, demonstrate that the mosaic symptoms observed in wild P. foetida were caused by TelMV infection. Additionally, TelMV was isolated from P. foetida in southern Taiwan as well. The amino acid sequences of the coat protein of two TelMV isolates from P. foetida shared over 98% identity with other TelMV isolates from passion fruit. To date, the natural hosts of TelMV include Telosma cordata, Pogostemon cablin, Senna alata, and P. edulis (Chiemsombat et al. 2014; Noveriza et al. 2016). P. foetida is a common wild host of viruses infecting Passiflora species (Leggat et al. 1975). It grows widely as a naturalized weed in tropical and subtropical regions, potentially serving as a virus reservoir, and therefore contributing to spread TelMV in passion fruit cultivation. To our knowledge, this is the first report that provides the evidence of TelMV naturally infecting P. foetida. These findings provide valuable insights for the management and prevention of TelMV infection in passion fruit crops.