Key points are not available for this paper at this time.
We have previously identified a 160-kDa protein in human embryonic kidney (HEK) 293 cells that undergoes rapid tyrosine phosphorylation in response to insulin (PY160) (Kuhné, M. R., Zhao, Z., and Lienhard, G. E. (1995) Biochem. Biophys. Res. Commun. 211, 190–197). The phosphotyrosine form of PY160 was purified from insulin-treated HEK 293 cells by anti-phosphotyrosine immunoaffinity chromatography, the sequences of peptides determined, and its cDNA cloned. The PY160 cDNA encodes a 1257-amino acid protein that contains, in order from its N terminus, a pleckstrin homology (PH) domain, a phosphotyrosine binding (PTB) domain, and, spread over the C-terminal portion, 12 potential tyrosine phosphorylation sites. Several of these sites are in motifs expected to bind specific SH2 domain-containing proteins: YXXM (7 sites), phosphatidylinositol 3-kinase; YVNM (1 site), Grb-2; and YIEV (1 site), either the protein-tyrosine phosphatase SHP-2 or phospholipase Cγ. Furthermore, the PH and PTB domains are highly homologous (at least 40% identical) to those found in insulin receptor substrates 1, 2, and 3 (IRS-1, IRS-2, and IRS-3). Thus, PY160 is a new member of the IRS family, which we have designated IRS-4. We have previously identified a 160-kDa protein in human embryonic kidney (HEK) 293 cells that undergoes rapid tyrosine phosphorylation in response to insulin (PY160) (Kuhné, M. R., Zhao, Z., and Lienhard, G. E. (1995) Biochem. Biophys. Res. Commun. 211, 190–197). The phosphotyrosine form of PY160 was purified from insulin-treated HEK 293 cells by anti-phosphotyrosine immunoaffinity chromatography, the sequences of peptides determined, and its cDNA cloned. The PY160 cDNA encodes a 1257-amino acid protein that contains, in order from its N terminus, a pleckstrin homology (PH) domain, a phosphotyrosine binding (PTB) domain, and, spread over the C-terminal portion, 12 potential tyrosine phosphorylation sites. Several of these sites are in motifs expected to bind specific SH2 domain-containing proteins: YXXM (7 sites), phosphatidylinositol 3-kinase; YVNM (1 site), Grb-2; and YIEV (1 site), either the protein-tyrosine phosphatase SHP-2 or phospholipase Cγ. Furthermore, the PH and PTB domains are highly homologous (at least 40% identical) to those found in insulin receptor substrates 1, 2, and 3 (IRS-1, IRS-2, and IRS-3). Thus, PY160 is a new member of the IRS family, which we have designated IRS-4. The insulin receptor is a tyrosine kinase, which when activated by insulin binding phosphorylates cellular substrates. The most well characterized of these are two members of the IRS 1The abbreviations used are: IRS, insulin receptor substrate; HEK, human embryonic kidney; HPLC, high performance liquid chromatography; IGF, insulin-like growth factor; PCR, polymerase chain reaction; PH, pleckstrin homology; PI, phosphatidylinositol; PTB, phosphotyrosine binding; RACE, rapid amplification of cDNA ends; SH2, Src homology 2; bp, base pair(s); nt, nucleotide(s); aa, amino acids.1The abbreviations used are: IRS, insulin receptor substrate; HEK, human embryonic kidney; HPLC, high performance liquid chromatography; IGF, insulin-like growth factor; PCR, polymerase chain reaction; PH, pleckstrin homology; PI, phosphatidylinositol; PTB, phosphotyrosine binding; RACE, rapid amplification of cDNA ends; SH2, Src homology 2; bp, base pair(s); nt, nucleotide(s); aa, amino acids. family, IRS-1 and IRS-2, and the protein Shc. Tyrosine phosphorylation of the IRS proteins creates binding sites for SH2 domain-containing signaling molecules, including PI 3-kinase, the adapter molecule Grb-2, and the protein-tyrosine phosphatase SHP-2. Docking of these proteins in turn activates specific signal transduction pathways (reviewed in Refs. 1Myers Jr., M.G. White M.F. Annu. Rev. Pharmacol. Toxicol. 1996; 36: 615-658Crossref PubMed Scopus (296) Google Scholarand 2Waters S.B. Pessin J.E. Trends Cell Biol. 1996; 6: 1-4Abstract Full Text PDF PubMed Scopus (63) Google Scholar). Recently, we have identified, by purification and cloning, a third member of the IRS family, called IRS-3, which in insulin-treated adipocytes is tyrosine-phosphorylated and associated with PI 3-kinase (3Lavan B.E. Lienhard G.E. J. Biol. Chem. 1993; 268: 5921-5928Abstract Full Text PDF PubMed Google Scholar, 4Lavan B.E. Lane W.S. Lienhard G.E. J. Biol. Chem. 1997; 272: 11439-11443Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar). All three IRS family members possess a common domain structure that includes PH and PTB domains at the N terminus and, C-terminal to these, a number of potential tyrosine phosphorylation sites (1Myers Jr., M.G. White M.F. Annu. Rev. Pharmacol. Toxicol. 1996; 36: 615-658Crossref PubMed Scopus (296) Google Scholar, 2Waters S.B. Pessin J.E. Trends Cell Biol. 1996; 6: 1-4Abstract Full Text PDF PubMed Scopus (63) Google Scholar, 4Lavan B.E. Lane W.S. Lienhard G.E. J. Biol. Chem. 1997; 272: 11439-11443Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar,5Sun X.J. Wang L-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (763) Google Scholar). The presence of these features can therefore be viewed as defining an IRS. Previously, we have identified a 160-kDa protein in HEK 293 cells, termed PY160, which is rapidly tyrosine-phosphorylated in response to insulin but which is immunologically unrelated to IRS-1 (6Kuhné M.R. Zhao Z. Lienhard G.E. Biochem. Biophys. Res. Commun. 1995; 211: 190-197Crossref PubMed Scopus (12) Google Scholar). In the present study we have isolated PY160 from insulin-treated HEK 293 cells and cloned its cDNA. The predicted amino acid sequence shows that PY160 is a new member of the IRS family. HEK 293 cells were grown on 10-cm plates as described previously (6Kuhné M.R. Zhao Z. Lienhard G.E. Biochem. Biophys. Res. Commun. 1995; 211: 190-197Crossref PubMed Scopus (12) Google Scholar). Before use, confluent plates of cells were incubated in serum-free medium for 2 h and then incubated for 5 min further with either no addition or the addition of 1 μm insulin to activate fully the insulin and IGF-1 receptors present on these cells (7Beitner-Johnson D. LeRoith D. J. Biol. Chem. 1995; 270: 5187-5190Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Each plate was rinsed with phosphate-buffered saline and lysed by the addition of 1 ml of 3% SDS, 10 mm dithiothreitol in Buffer A (50 mm Hepes, 100 mm NaCl, 2 mm EDTA, 1 mm sodium vanadate, pH 7.4, with protease inhibitors (10 μm EP475, 10 μm leupeptin, 10 μg/ml aprotinin, 1 nm pepstatin A, 4 mm diisopropyl fluorophosphate)). The lysate was held at 100 °C for 5 min, and the DNA in it was sheared by repeated passage through a syringe needle. Finally, the lysate was diluted by the addition of 5 ml of 3% Triton X-100 in Buffer A; free sulfhydryl groups were capped by the addition of N-ethylmaleimide to a final concentration of 6.7 mm; and the lysate was clarified by centrifugation at 150,000 × g for 1 h. Aliquots of lysates (1 ml) from basal and insulin-stimulated 293 cells were incubated with anti-Tyr(P) antibodies (20 μl of 4G10 agarose from Upstate Biotechnology) for 4 h at 4 °C. The beads were washed twice with a wash buffer (50 mm Hepes, 100 mm NaCl, 1.5% Triton X-100. 0.25% SDS, 1 mm sodium vanadate with protease inhibitors, pH 7.4), and the Tyr(P)-containing proteins were eluted by the addition of 135 μl of 40 mm phenyl phosphate in the wash buffer. To estimate the recovery of PY160, samples containing the original extract, the depleted extract, and the phenyl phosphate eluate were immunoblotted for Tyr(P), as described (3Lavan B.E. Lienhard G.E. J. Biol. Chem. 1993; 268: 5921-5928Abstract Full Text PDF PubMed Google Scholar). The yield of the Tyr(P) form of PY160 by immunoadsorption from the lysate of insulin-treated cells was approximately 15%. PY160 was purified by anti-Tyr(P) affinity chromatography from an extract derived from a total of thirty-six 10-cm plates of insulin-stimulated HEK 293 cells. In a single purification, half of the extract (110 ml) was passed at 0.2 ml/min through a 1.0-ml column of goat IgG-agarose (Sigma) and then through a 1.5-ml column of immobilized anti-Tyr(P) antibody (4G10 agarose at 1 mg/ml). Once the extract was applied, the goat IgG column was disconnected, and the anti-Tyr(P) column was washed sequentially with (a) 30 ml of 1% Triton X-100, 0.25% SDS in wash buffer (20 mm Tris-HCl, 150 mm NaCl, 1 mm sodium vanadate, pH 7.4, with protease inhibitors (2 μg/ml aprotinin, 2 μm leupeptin, 0.2 nmpepstatin A)) at 1 ml/min, (b) 30 ml of 1% Triton X-100 in wash buffer with protease inhibitors at 1 ml/min, (c) 300 ml of 0.05% Triton X-100 in wash buffer with protease inhibitors at 0.3 ml/min, and (d) 7 ml of 0.015% sodium deoxycholate in wash buffer at 0.5 ml/min. Elution buffer (3 mm phenyl phosphate, 0.015% sodium deoxycholate in wash buffer) was run onto the column and the flow stopped for 10 min. Tyr(P)-containing proteins were then eluted at 0.5 ml/min, and 2-ml fractions were collected in low protein adsorption tubes (Nunc no. 443990). The purification was repeated with the other half of the lysate, and the two fractions from each preparation containing the bulk of the PY160 were concentrated by trichloroacetic acid precipitation as detailed in Ref. 3Lavan B.E. Lienhard G.E. J. Biol. Chem. 1993; 268: 5921-5928Abstract Full Text PDF PubMed Google Scholar. The precipitates were resuspended in SDS sample buffer and separated in a single lane on a 7% acrylamide gel. Following transfer to ProBlott membrane (Applied Biosystems) and staining with Amido Black, the band corresponding to PY160 was excised (about 1.5 μg (10 pmol)). The protein band was subjected to in situ digestion with LysC; the resultant peptides were separated by microbore HPLC; selected fractions were screened by MALDI-TOF mass spectrometry and microsequenced by the methods described previously (4Lavan B.E. Lane W.S. Lienhard G.E. J. Biol. Chem. 1997; 272: 11439-11443Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar). By UV absorbance, approximately 1–5 pmol of peptides were present in the HPLC separation. Total RNA was obtained from HEK 293 cells using the Trizol reagent (Life Technologies, Inc.), and mRNA was subsequently purified from it using the Fast-Track kit (Invitrogen). A 10-cm plate of confluent HEK 293 cells yielded about 3 μg of mRNA. A Marathon ReadyTM cDNA library from human fetal kidney was obtained from CLONTECH. The nucleotide sequence encoding the central portion of peptide a (see “Results and Discussion” for peptides) was obtained by PCR amplification. The sequences of the N and C termini of peptide a were used to design degenerate oligonucleotides; restriction sites forEcoRI (sense) and BamHI (antisense) were incorporated to facilitate cloning (5′GCGAATTCYTNGARACNGCNGA3′ and 5′GAGGATCCGCRTTYTCRTARTA3′, where Y is C or T, R is A or G, and N is A, C, G, or T; restriction sites are underlined). cDNA, produced by random hexamer primed reverse transcription of HEK 293 mRNA, was used as the template. A PCR product of the expected size (63 bp) was obtained and cloned into theEcoRI/BamHI site of pBluescript II (SK−). Several clones were sequenced and found to encode the middle portion of the peptide (APARLE; nt 390–408). The 5′-end of the cDNA was obtained in two separate 5′-RACE reactions. In the first, a degenerate antisense primer derived from the C terminus of peptide a (5′TTNCGNGCRTTYTC3′ and 5′TTYCTNGCRTTYTC3′ mixed in a 2:1 molar ratio, respectively) was used to reverse transcribe HEK 293 mRNA. The resulting cDNA was tailed with dCTP and amplified by PCR with an antisense primer derived from the sequence encoding the middle portion of peptide a (5′TCRTARTATTCCAGCCGAGCT3′; exact sequence underlined, see above) and the abridged anchor primer of a 5′-RACE kit, according to the manufacturer's instructions (Life Technologies, Inc.). The products were reamplified using a nested antisense primer (derived from the N terminus of peptide a (5′TGGGGCGTCNGCNGTYTC3′)) and the abridged universal amplification primer of the kit. A 330-bp product was purified and cloned into pCR-Script (Stratagene), and the sequences of five clones were determined (nt 90–378). In the second 5′-RACE, the Marathon ReadyTM cDNA library from human fetal kidney was amplified with an antisense primer (nt 352–371) and the AP1 primer of the kit according to the manufacturer's instructions. The reaction mixture was reamplified using a nested antisense primer (nt 270–290) and the AP2 primer of the kit. A mixture of PCR products with a size range of 300–330 bp was purified and sequenced directly (nt 1–267). Upstream of nt 1 the sequence was a mixture; this may reflect heterogeneity in the start point of the PY160 mRNA. The 3′-portion of PY160 cDNA was obtained in a number of 3′-RACE reactions. cDNA was synthesized from HEK 293 mRNA using either degenerate antisense primers derived from the sequences of peptide b (5′XACDATNACYTGCCANACRT3′) and peptide c (5′XTTNCCRAARTARCTNC3′ and 5′XTTNCCRAARTANGANC3′ in a 1:2 molar ratio, respectively) or using oligo(dT) (X(T)17, where X is an adapter sequence 5′GGCCACGCGTCGACTAGTAC3′ and D is A, G, or T). A 550-bp PCR product (produced from amplification of peptide b-primed cDNA using a sense primer (nt 243–260) and the adapter primer) and a 1200-bp PCR product (produced from amplification of peptide c-primed cDNA using a sense primer (nt 754–774) and the adapter primer) were cloned into pCR-Script. The inserts of several clones were sequenced and were found to encode nt 266–774 (peptide b primed) and nt 775–1914 (peptide c primed). The remainder of the sequence was obtained by 3′-RACE using oligo(dT)-primed cDNA. This cDNA was amplified using either of two upstream sense primers (nt 1762–1783 and nt 2956–2978) and the adapter primer. A 1300-bp PCR product was obtained with the nt 1762–1783 primer, while the nt 2956–2978 primer yielded a 980-bp product. These two products which are shorter than the sizes expected from the size of the PY160 mRNA (see “Results and Discussion”) most likely arise due to internal priming by the oligo(dT) primer. The 1300- and 980-bp PCR products were sequenced directly (nt 1840–3052 and nt 2979–3939, respectively). To confirm the DNA sequence, overlapping fragments were generated by PCR amplification of cDNA obtained by random hexamer-primed reverse transcription of total RNA from HEK 293 cells and sequenced directly on both strands (nt 170–637, 598–1124, 1076–1704, 1651–2308, 2139–2889, 2722–3302, and 3200–3898). Sequencing was performed on the Applied Biosystems 373 DNA sequencing system using the Perkin-Elmer DNA sequencing kit; data were analyzed with the Applied Biosystems software. Homology searches were performed with the BLAST program (8Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (69731) Google Scholar). Treatment of HEK 293 cells with insulin elicits the tyrosine phosphorylation of a protein of approximately 160 kDa, which is immunologically distinct from IRS-1 (6Kuhné M.R. Zhao Z. Lienhard G.E. Biochem. Biophys. Res. Commun. 1995; 211: 190-197Crossref PubMed Scopus (12) Google Scholar). Immunoblotting of HEK 293 cell lysates with antibodies to IRS-2 detected a protein larger than PY160; this result indicated that PY160 was also not IRS-2 (data not To the of PY160 by anti-Tyr(P) immunoaffinity chromatography, we performed with anti-Tyr(P) immobilized on agarose were from basal and insulin-stimulated HEK 293 cells, incubated in the presence or of phenyl phosphate with and then with anti-Tyr(P) The proteins were eluted with phenyl phosphate and analyzed by and protein 1 shows the eluted Tyr(P) proteins as detected by anti-Tyr(P) Tyr(P) proteins were the size expected for the Tyr(P) form of The on its size of about 100 kDa, is most likely a mixture of the tyrosine-phosphorylated of the insulin and IGF-1 both receptors are present in HEK 293 cells, and the be expected to be activated at 1 μm insulin (7Beitner-Johnson D. LeRoith D. J. Biol. Chem. 1995; 270: 5187-5190Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). staining of the a single which with the Tyr(P) form of PY160 1, The recovery of this protein from of basal and insulin-treated cells the recovery of the Tyr(P) form of PY160; this that the protein was PY160 1, 5 with 1 and The binding to the anti-Tyr(P) beads was no proteins were present in the from anti-Tyr(P) of lysates with phenyl phosphate 1, 3 and 4 and The in 1 that it be to PY160 from HEK 293 cells by anti-Tyr(P) chromatography in an to peptide A purification was performed by a of a that we previously used to Tyr(P) proteins from insulin-treated adipocytes (3Lavan B.E. Lienhard G.E. J. Biol. Chem. 1993; 268: 5921-5928Abstract Full Text PDF PubMed Google (see This yielded PY160 to of the sequences of five and (see A of the data base using the BLAST program that peptides a and b homology with sequences in PCR products PY160 were obtained by and 3′-RACE using HEK 293 mRNA or a human fetal kidney cDNA and sequences were The nucleotide sequence and predicted amino acid sequence of PY160 are in from nt to encodes a 1257-amino acid that the sequences of five PY160 is not that the at nt an at nt also to the human sequence for Res. 1996; PubMed Scopus Google Scholar). is no upstream of the the for PY160 an nt upstream of the corresponding to nt in the human sequence (data not is therefore likely that at either of these two the is the predicted mass of PY160 is kDa, a that is than the size of approximately 160 for the Tyr(P) form by SDS The for the is most likely an low on as is the for IRS-1 Lienhard G.E. Biophys. 1993; PubMed Scopus Google Scholar). The that no sequence is present at the of the cDNA that the sequence In with this of HEK 293 mRNA using either of two derived from the PY160 cDNA (nt and of and 10 (data not of that the predicted protein is as described the structure of the protein is that expected for a of the insulin we have antibodies the C-terminal peptide amino of the predicted protein and used these to its with from and insulin-treated 293 cells were with the antibodies the C-terminal and then were immunoblotted with antibodies Tyr(P) as well as those the C-terminal The from the and insulin-treated cells of a 160-kDa as detected with the antibodies the and its tyrosine phosphorylation was in insulin-treated cells (data not A of the amino acid sequence of PY160 with the data base and an for the presence of potential tyrosine phosphorylation sites that PY160 contains, in order from its N terminus, a PH domain, a PTB domain, and spread over the C-terminal portion, 12 potential tyrosine phosphorylation sites 3 This is the as that of the three members of the IRS family (see the PY160 is a new member of the IRS family, and we to it as IRS-4. is of a to both IRS-1 and IRS-2 for human IRS-1 and for IRS-2 X.J. Wang L-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (763) Google sequence with IRS-1 and IRS-2 and respectively). homology is found in the PH and PTB The PH domain of of amino and a high of homology with the domain in IRS-2, and and respectively) 3 This high of a common for the PH domain in IRS family In the PH domain is for tyrosine phosphorylation by the insulin receptor in it not to directly with the receptor Jr., M.G. J. Glasheen Wang L-M. X.J. J. Pierce J.H. White M.F. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar, D. Y. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar, L. J. Myers Jr., M.G. White M.F. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). The PTB domain of of amino and a high of homology with this domain in IRS-2, and and respectively). The structure of the IRS-1 PTB domain with a Tyr(P) peptide on the in the insulin receptor determined 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). of the amino in IRS-1 that with the peptide are in including the two groups the phosphate of the Tyr(P) 3 Thus, it is likely that the PTB domain in also be found to bind to the activated insulin receptor by with the Tyr(P) IRS-1 and IRS-2 which are for with the insulin These are a domain of the PTB domain, to as the domain in human IRS-1 and by homology in and a second domain C-terminal to the domain that is present in IRS-2 L. J. Myers Jr., M.G. White M.F. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar, W. Mol. Biol. 1995; PubMed Scopus Google Scholar, W. Y. Wang L-M. Pierce J.H. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar, D. White M.F. E. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). is these domains and the corresponding in IRS-4. be of to these in also with the insulin the 12 potential tyrosine phosphorylation sites in are in YXXM motifs and 3 This in its Tyr(P) to the SH2 domains of the PI 3-kinase Z. M. Gish G. J.E. 1993; Full Text PDF PubMed Scopus Google Scholar). also a potential tyrosine phosphorylation site in a that is expected to bind the SH2 domain of Grb-2, the adapter for for and site in the expected to bind the SH2 domain of either the Tyr(P) phosphatase SHP-2 or phospholipase Z. M. Gish G. J.E. 1993; Full Text PDF PubMed Scopus Google Scholar, Z. J. M. D. Mol. Biol. PubMed Scopus Google Scholar). In we have found that PI 3-kinase and with from lysates of HEK 293 cells, with of each associated with insulin of the cells. J. D. G. E. Lienhard, and E. in to be determined with SHP-2 or phospholipase Cγ. IRS-2, and also the motifs for binding PI 3-kinase, Grb-2, and SHP-2 (4Lavan B.E. Lane W.S. Lienhard G.E. J. Biol. Chem. 1997; 272: 11439-11443Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar, X.J. Wang L-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (763) Google and the of these motifs in IRS-2, and 3 A and Ref. X.J. Wang L-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (763) Google is an of the homology these This in with of (4Lavan B.E. Lane W.S. Lienhard G.E. J. Biol. Chem. 1997; 272: 11439-11443Abstract Full Text Full Text PDF PubMed Scopus (309) Google the of are members of the IRS family to be A is to the of each IRS in signaling from the insulin and IGF-1 receptors and other receptors as We and for in the HPLC, peptide and mass
Lavan et al. (Fri,) studied this question.