The polymorphic (TG)n repeat begins at the 10313 base pair of the human int-2 proto-oncogene locus on chromosome 1 1q13 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 167 bp. Primer Sequences: TTTCTGGGTGTGTCTGAAT (TG strand); ACACAGTTGCTCTAAAGGGT (AC strand).
No takes yet. Share an insight, caveat, or question.
Polymeropoulos et al. (1990) studied this question.