First report of tomato zonate spot virus infecting Actinidia chinensis Planch. in China

Kiwifruit (Actinidia chinensis Planch.), a member of the family Actinidiaceae and genus Actinidia, is a commercially important fruit. China is the center of origin for Actinidia species and remains the world's largest producer of cultivated kiwifruit. In July 2025, 25 kiwifruit samples exhibiting leaf mosaic symptoms and pinpoint chlorotic lesions on leaf tissue were collected from Kunming City, Yunnan Province (Figure S1A). To investigate potential viral infections, total RNA was extracted from pooled samples using the HiPure Universal RNA Mini Kit (Magen), and ribosomal RNA was depleted via probe hybridization to enrich for viral RNA. Libraries were subjected to virome sequencing on the Illumina HiSeq platform. Raw RNA sequencing reads were analyzed using CLC Genomics Workbench 12 (Qiagen). De novo assembly yielded 2,356 viral-associated contigs. Subsequent Blastn analysis against the non-redundant (nr) nucleotide database identified three contigs with an E-value of 0, the lengths of the contigs were 2,183 nt, 3,614nt, 7,492 nt and showing 96.8%, 94.4% and 98.2% nucleotide identity with the S RNA of the TZSV konjac isolate (LC771058), M RNA of the TZSV Iris isolate (PP314223), L RNA of the TZSV Amorphophallus muelleri isolate (OR603945), respectively. TZSV is a member of the genus Orthotospovirus (order Bunyavirales, family Tospoviridae). First identified in tomato (Solanum lycopersicum) and pepper (Capsicum annuum) in China (Dong et al., 2008), TZSV has subsequently been reported in several economically important crops and alternative weed hosts, including tobacco (Nicotiana tabacum) (Cai et al., 2008), iris (Iris sp.) (Liu et al., 2015), potato (Solanum tuberosum) (Huang et al., 2015), and bidens (Bidens sp.) (Xu et al., 2022). To confirm TZSV infection in the collected samples, reverse transcription‑polymerase chain reaction (RT-PCR) was performed using specific primers targeting the nucleocapsid (N) gene (TZSV-Nf: GCAATGATCTGTCTTTTTAA; TZSV-Nr: ATGTCTAACGTCCGGAGTTT). An amplicon of the expected size (837 bp) was successfully amplified from one of the 25 samples and subsequently confirmed by Sanger sequencing (Figure S1C). The deduced amino acid sequence of the TZSV N protein shared 97.8% identity with that of a previously reported TZSV tomato isolate (NC_010489). Orthotospovirus-like spherical virions with a diameter of 100 nm were observed in sap extracted from infected leaves by negative staining electron microscopy (Figure S1B). To further characterize the complete genome of the TZSV isolate infecting kiwifruit, the full-length sequences of the S, M, and L RNA segments were obtained via RT-PCR and rapid amplification of cDNA ends (RACE). The S RNA (3,065 nt, accession NO. PZ013408), M RNA (4,948 nt, accession NO. PZ013409), and L RNA (8,916 nt, accession NO. PZ013410) segments were determined. Sequence analysis revealed that the S RNA shared 96.3% nucleotide identity with a previously reported TZSV isolate from Capsicum annuum (LC771058), with its encoded N and NSs proteins sharing 96.8% and 99.6% amino acid identity, respectively. The M RNA exhibited 95.3% nucleotide identity with a TZSV isolate from konjac (OR911351); the NSm and Gn/Gc proteins shared 97.7% and 98.9% amino acid identity, respectively. The L RNA shared 96.0% nucleotide identity with a TZSV tomato isolate (NC_010489), and the RNA-dependent RNA polymerase (RdRp) shared 94.0% amino acid identity. Phylogenetic trees were constructed using the maximum-likelihood (ML) method in MEGA 7.0 with 1,000 bootstrap replicates. Based on the amino acid sequences of the N, NSs, NSm and RdRp proteins, the TZSV-kiwifruit isolate clustered closely with most known TZSV isolates. However, in the phylogenetic tree constructed using the Gn/Gc protein sequence, the kiwifruit isolate formed a distinct evolutionary branch, suggesting unique genetic variation associated with its adaptation to this woody vine plant host (Figure S2). It is noteworthy that TZSV was detected in only one of the 25 symptomatic kiwifruit samples. Further screening revealed that the other symptomatic samples were infected with common kiwifruit viruses, such as Actinidia virus A (AcVA), Actinidia virus B (AcVB), Actinidia virus C (AcVC), Actinidia seed-borne latent virus (AcSBLV), Actinidia virus 1 (AcV1) and Actinidia chlorotic ringspot-associated virus (AcCRaV). This indicates that the leaf mosaic and chlorotic symptoms observed in the field are likely the result of complex viral infections. The low detection rate of TZSV suggests that it may be an occasional pathogen in kiwifruit in most field samples. Alternatively, TZSV might be an emerging virus in this host, and its prevalence remains to be fully elucidated through large-scale epidemiological surveys. Future studies should focus on the pathogenicity of TZSV in kiwifruit through controlled inoculation experiments to confirm its role in disease development. To our knowledge, this study represents the first complete genome sequence of TZSV isolated from kiwifruit in China.