Angiotensin‐converting enzyme gene rs4343 polymorphism increases susceptibility to migraine

Migraine is a painful headache characterized by recurrent attacks. The pathophysiology of migraine is not yet fully comprehended. Based on different studies, there are several hypotheses about the mechanisms of the disease pathogenesis including vascular, neuroactive, and vasoactive substances.1 One of the important proteins with a key role in the modulation of the vascular tension and blood pressure is angiotensin I-converting enzyme (ACE) that is involved in the renin-angiotensin-aldosterone system.2 In addition, it is suggested that serum level of ACE is higher in people with migraine than in healthy controls.3 The serum level of ACE is strongly influenced by the genetic variations in the ACE gene.2 Previous studies reported an association between rs4343 and the enzyme activity.4, 5 The aim of this study was to investigate the possible association between rs4343 polymorphism in the ACE gene and migraine. Rs4343 is located in exon 17 of the ACE gene and results in Thr 776 Thr (NP_000780.1). In this case-control study, 297 subjects were enrolled, including 148 patients (105 patients without aura [MO] and 43 patients with aura [MA]) and 149 age- and sex-matched healthy controls. Diagnosis of migraine was confirmed according to the results of neurological examination and brain imaging studies and in accordance with International Classification of Headache Disorders 3 (ICHD-3) criteria. The study protocol was approved by the Ethics Committee of the Shahid Beheshti University of Medical Sciences (SBMU) (Code No.: IR.SBMU. MSP.REC.1395.527). We used the tetra-primer amplification refractory mutation system-PCR (TP-ARMS-PCR) method for the genotyping of rs4343. The primers used in the PCR included one pair of outer primers (FO [5′ CATTTCTGAAATTCTCTGAGCTCCCCT 3′] and RO [5′ TTTAGGAAAATGAAGGGACCCAAGTGC 3′]) and one pair of inner primers (Fi [5′ CATATTTGACGAATGTGATGGCCCCA3′] and Ri [5′CCAATAACAGGTCTTCATATTTCCGGTAC 3′]). PCR was performed with 25 μL of reaction solution containing 3 pmol/L of forward outer, 5 pmol/L of reverse outer, 12 pmol/L of forward inner, and 10 pmol/L of reverse inner primers, 100 ng of genomic DNA, 12.5 μL of Taq DNA Polymerase 2× Master Mix Red (Ampliqon, Odense, Denmark). Amplifications were carried out on a GeneTouch thermal cycler (Bioer, Zhejiang, China) with the following program: one cycle of 94°C for 1 minutes; 30 cycles of 94°C for 35 seconds, 61°C for 45 seconds, 72°C for 35 seconds; and one cycle of 72°C for 4 minutes. The products were electrophoresed on 2% agarose gel containing 0.5× TBE buffer. The genotype distribution in the controls and patients was all in complete Hardy-Weinberg equilibrium. Table 1 shows the allele and genotype frequencies for rs4343 polymorphism in both case and control groups. The association was found between rs4343 A/G polymorphism and migraine (P=.019; OR=0.48; 95% CI, 0.28-0.89). Table 2 shows the allele and genotype frequencies in both MA and MO groups. The GG genotype was significantly higher in MA patients compared with MO subjects (P=.042; OR=3.14, 95% CI=1.04-9.50). In addition, considering the G allele, a significant difference was observed under recessive model (P=.0049; OR=4.17; CI=1.54-11.27). We used the HaploReg v4 software to predict the impact of the studied SNP on regulatory motifs and the expression of the ACE gene (http://archive.broadinstitute.org/mammals/haploreg/haploreg.php). Rs4343 could alter regulatory motifs for several transcription factors including Ehf, Elf3, Ets, and TR4 and hence may affect the ACE serum level. It is suggested that this polymorphism affects metabolite levels, metabolic traits, tissue specificity, or ACE activity for substrates.5, 6 According to a previous study, migraineurs have nearly doubled frequency of cardiovascular diseases (CVDs) history in their relatives compared to the healthy controls.7 Based on these data, the same genetic factors can anticipate for the development of both migraine and cardiovascular disorders. The association between rs4343 polymorphism and many diseases has been studied previously. The GG genotype of the ACE rs43434 polymorphism was significantly more frequent in the patients with essential hypertension, left ventricular hypertrophy, and coronary artery diseases.8, 9 Moreover, hypertension, one of the common risk factors for migraine and CVDs, is associated with rs4343.6 Therefore, the GG genotype can be considered as a genetic factor for increasing the risk of migraine and CVDs. The angiotensin-converting enzyme inhibitors (ACEI) are a class of drugs used as medication in the treatment of migraine.10 Subjects with higher ACE activity are more responsive to ACEI drugs than those with lower ACE activity. Therefore, ACE polymorphisms may remarkably affect the drug response in the migraineurs. Recently, genome-wide analysis studies identified that the ACE rs4343 and ABO rs495828 and rs8176746 polymorphisms are good predictors of ACE activity.4 Hence, rs4343 may be considered as a good predictor for the drug response in migraineurs. In conclusion, the result of our study showed the association between rs4343 and susceptibility to migraine. To the best of our knowledge, this is the first study concerning the association between rs4343 polymorphism and susceptibility to migraine. Further studies are required to validate the significance of the studied genetic variation in diverse ethnic populations. The authors would like to thank all the participants of the study. The present article is financially supported by “Research Department of the School of Medicine Shahid Beheshti University of Medical Sciences” (Grant No. 10175). The authors declare no conflict of interest.