MAOA variants differ in oscillatory EEG & ECG activities in response to aggression-inducing stimuli

Figures

• 

  Figure 1. Genomic structure of the MAOA uVNTR polymorphism. (a) Nucleotide sequence alignment of the MAOA uVNTR alleles 2.5R, 3.5R, and 4.5R. 1R of each MAOA uVNTR allele consisted of a 30 bp “ACCGGCACCGGCACCAGTACCCGCACCAGT” sequence, followed by the first half-sequence of “ACCGGCACCGGCACC” in the last 0.5R. (b) Visualization of the different MAOA genotypes of the Korean population in 3% agarose gel. Lanes 1 and 2 are 3.5R/Y and 4.5R/Y from men; lanes 3, 4, 5, 6 and 7 are 3.5R/3.5R, 4.5R/4.5R, 2.5R/3.5R, 2.5R/4.5R, and 3.5R/4.5R from women, respectively. The full gel is presented in Fig. S7a.

• 

  Figure 2. Transcriptional efficiency of MAOA promoter fusions. (a) Schematic diagram of the 1.5 kb promoter organization with the 4.5R allele. Sites from −1262 to −1127 are for the position of MAOA uVNTR alleles and sites −1470 to +35 are for cloning into the promoter fusion vector. The sites for the core promoter and three GRE/AREs (grey blocks) are also shown. GRE, Glucocorticoid response element; ARE, Androgen response element. (b,c) Reporter gene assays. MAOA promoter constructs carrying the 2.5R, 3.5R, or 4.5R alleles fused to firefly luciferase were co-transfected with a plasmid containing Renilla luciferase into SH-SY5Y cells and JAR cells. Empty pcDNA vector was used as a negative control (−). Data are presented as the ratio of firefly to Renilla luciferase activity (mean ± SEM) from one of three independent experiments with 4–8 wells. *, **, and *** above the horizontal lines indicate statistically significant differences among MAOA uVNTR alleles at p < 0.05, 0.01, and 0.001, respectively, by one-way ANOVA with Tukey’s post hoc test; * and ** above the bar graph indicate statistically significant differences between the negative control group and MAOA uVNTR alleles at p < 0.05 and…

• 

  Figure 3. Comparisons of the EEG γ response at F8 across MAOA genotypes. (a) Power spectral density of the γ wave at F8. The panels represent power spectral density by time (10–117.75 s) and frequency (30–90 Hz) intervals across MAOA genotypes. At the bottom of each panel, the first arrow represents the start of the NS (19 s), and the second arrow represents the start of S (stimulus, 28 s). (b,c) represent the MSE value of the γ wave at F8 during NS and S between MAOA genotypes in men and women, respectively. (d,e) represent the relative power value of the γ wave at F8 during NS and S between MAOA genotypes in men and women, respectively. All values are represented as the means ± SEM. The sample size for EEG measurement was 84, including 36 men (21 for 3.5R/Y, 15 for 4.5R/Y) and 48 women (23 for 3.5R/3.5R, 5 for 4.5R/4.5R, and 20 for the heterozygous group). *, **, and *** above the horizontal lines indicate statistically significant differences between MAOA genotypes at p < 0.05, 0.01, and 0.001, respectively, by repeated measures of two-way ANOVA with Bonferroni post hoc test; * and ** above the graph bars indicate statistically significant differences between NS and S at p < 0.05 and…

• 

  Figure 4. Comparison of ECG across MAOA genotypes. ECG signals were used to calculate HR (unit: BPM) and were converted to values relative to baseline. (a,b) represent average HR during NS and S between MAOA genotypes in men and women, respectively. (c,d) represent ΔHR during NS and S between MAOA genotypes in men and women, respectively. (e,f) represent variance in HR during NS and S between MAOA genotypes in men and women, respectively. All values are represented as the means ± SEM. The ECG sample size was 70, including 30 men (18 for 3.5R/Y, 12 for 4.5R/Y) and 40 women, (20 for 3.5R/3.5R, 3 for 4.5R/4.5R, and 17 for the heterozygous group). * and ** above the horizontal line indicate statistically significant differences between MAOA genotypes at p < 0.05 and 0.01, respectively, by repeated measures of two-way ANOVA with Bonferroni post hoc test; *, **, and *** above the graph bar indicate statistically significant differences between NS and S at p < 0.05, 0.01, and 0.001, respectively, by repeated measures of two-way ANOVA with Bonferroni post hoc test.