The lectin-like domain of thrombomodulin is a drug candidate for both prophylaxis and treatment of liver ischemia and reperfusion injury in mice

Figures

• 

  FIGURE 1. rTM and each rTM domain protein used in this study. A, The structures of rTM and each rTM domain protein are illustrated schematically. B, rTM and rTMD1 were detected by western blotting analysis using anti‐TM antibody and anti‐Myc‐Tag antibody, respectively. rTM, recombinant human thrombomodulin; rTMD1, the domain 1 of recombinant thrombomodulin; TM, thrombomodulin

• 

  FIGURE 2. Pretreatment with rTMD1 ameliorates liver IRI in mice in a dose‐dependent manner by inhibiting TLR‐4‐mediated signaling. A, The hepatocellular damage was measured by the serum level of ALT. High dose (18 mg/kg) or low dose (1.8 mg/kg) of rTMD1 was administered intravenously to WT or TLR‐4 KO mice 30 min before the ischemia maneuver. IR‐treated mice were given saline only. Sham‐operated mice underwent the same procedure but without vascular occlusion (n = 8 mice/group; *P < .05, ***P < .001). B, Representative liver histology (hematoxylin and eosin staining) after IR insult in WT mice (magnification ×400). C, Suzuki's histological grading in each group (n = 8 mice/group; *P < .05). D, Representative immunohistochemistry of Ly‐6G (dark brown spots) at 6 h of reperfusion (magnification ×400; in box, ×800). E, Quantitation of hepatic Ly‐6G accumulation (n = 8 mice/group; *P < .05). F, Representative immunohistochemistry of CD11b (dark brown spots) at 6 h of reperfusion (magnification ×400; in box, ×800). G, Quantitation of hepatic CD11b accumulation (n = 8 mice/group; **P < .01). H, Each rTM domain protein was administered 30 min before initiating liver ischemia, and sALT was…

• 

  FIGURE 3. The assessment of apoptosis in hepatocytes after liver IR. A, Representative TUNEL‐assisted detection of hepatic apoptosis in liver tissues after IR (magnification ×400). B, Quantification of hepatic apoptosis (n = 6 mice/group; ***P < .001). C, Western blot–assisted expression of cleaved caspase‐3 at 6 h of reperfusion after 60 min of ischemia. β‐actin was used as internal control. IR, ischemia and reperfusion; TUNEL, terminal deoxynucleotidyl transferase‐mediated deoxyuridine triphosphate nick‐end labeling

• 

  FIGURE 4. rTMD1 pretreatment suppressed pro‐inflammatory cytokines and chemokine. Quantitative reverse transcription‐polymerase chain reaction detection of pro‐inflammatory cytokines (TNF‐α, IL‐6, IL‐1β, CXCL‐1, and CXCL‐2) at 6 h of reperfusion. rTMD1 was administered before the initiation of ischemia. Data were normalized to β‐actin gene expression (n = 6 mice/group; *P < .05, **P < .01). The primer couples used to amplify specific gene fragments are as follows. IL‐6: (f) ACCAGAGGAAATTTTCAATAGGC, (r) TGATGCACTTGCAGAAAACA; TNF‐α: (f) AGGGTCTGGGCCATAGAACT, (r) CCACCACGCTCTTCTGTCTAC; IL‐1β: (f) CAGGTCGCTCAGGGTCACA, (r) CAGAGGCAAGGAGGAAACACA; CXCL‐1: (f) GCTTGAAGGTGTTGCCCTCAG, (r) AAGCCTCGCGACCATTCTTG; CXCL‐2: (f) TCCAGGTCAGTTAGCCTTGC, (r) CGGTCAAAAAGTTTGCCTTG; f, forward; r, reverse. rTMD1, the domain 1 of thrombomodulin; TNF‐α, tumor necrosis factor‐α

• 

  FIGURE 5. The levels of serum HMGB‐1 and expression of TLR‐4. A, The levels of serum HMGB‐1 at 1 and 6 h after reperfusion in IR‐treated and rTMD1‐pretreated mice (n = 8 mice/group; **P < .01). B, The expression of TLR‐4 in liver tissues at 6 h after reperfusion in IR‐treated and rTMD1‐pretreated mice. HMGB‐1, high‐mobility group box 1 protein; IR, ischemia and reperfusion; rTMD1, the domain 1 of thrombomodulin; TLR‐4, Toll‐like receptor 4

• 

  FIGURE 6. rTMD1 suppressed HMGB‐1‐mediated activation of peritoneal macrophages. A, Peritoneal macrophages from WT or TLR‐4 KO mice were cultured with HMGB‐1 (1 µg/mL) alone or with the mixture of HMGB‐1 (1 µg/mL) and rTMD1 (5, 10, and 30 µg/mL, respectively) for 48 h. TNF‐α release was measured by ELISA (n = 3 samples/group; *P < .05, **P < .01). B, Peritoneal macrophages from WT mice were cultured with HMGB‐1 (1 µg/mL) alone or with the mixture of HMGB‐1 (1 µg/mL), and each rTM domain protein (rTM, rTMD1, rTMD2, rTMD3; 5 and 30 µg/mL, respectively) for 48 h. TNF‐α release was measured by ELISA (n = 3 samples/group; **P < .01, ***P < .001). ELISA, enzyme‐linked immunosorbent assay; HMGB‐1, high‐mobility group box 1 protein; rTM, recombinant human thrombomodulin; rTMD1, the domain 1 of thrombomodulin; TLR‐4 KO, tlr‐4 gene–deleted; TNF‐α, tumor necrosis factor‐α; WT, wild‐type

• 

  FIGURE 7. rTMD1 ameliorated IR‐induced liver damage even after IRI had occurred. A, WT mice were divided into 4 groups: Control group mice were treated with saline instead of rTMD1 before initiating liver ischemia; Group A, rTMD1 was administered 30 min before initiating liver ischemia; Group B, rTMD1 was administered immediately after initiation of reperfusion; Group C, rTMD1 was administered 1 h after reperfusion was initiated. B, sALT in Group A, B, C, and Control group (n = 8 mice/group; ***P < .001). C, Representative liver histology (hematoxylin and eosin staining) after IR insult in each group (magnification ×400). D, Suzuki's histological grading in each group (n = 8 mice/group; ***P < .001). IR, ischemia and reperfusion; IRI, ischemia and reperfusion injury; rTMD1, the domain 1 of thrombomodulin; sALT, serum alanine aminotransferase; WT, wild‐type

• 

  FIGURE 8. rTMD1 can suppress TNF‐α production even after the addition of HMGB‐1. A, Peritoneal macrophages from WT mice were divided into 5 groups. Nonstimulated group, macrophages were cultured with culture fluid alone; Control group, macrophages were cultured with HMGB‐1 (1 µg/mL); Group A, rTMD1 (30 µg/mL) was added to the macrophages 30 min prior to the addition of HMGB‐1 (1 µg/mL); Group B, rTMD1 (30 µg/mL) and HMGB‐1 (1 µg/mL) were first mixed in a tube and incubated for 30 min, and then mixtures were added together to macrophages; Group C, rTMD1 (30 µg/mL) was added to the macrophages 30 min after the addition of HMGB‐1 (1 µg/mL). All cells were cultured for 48 h. B, TNF‐α release was measured by ELISA (n = 3 samples/group; *P < .05, **P < .01, ***P < .001). ELISA, enzyme‐linked immunosorbent assay; HMGB‐1, high‐mobility group box 1 protein; rTMD1, the domain 1 of thrombomodulin; TNF‐α, tumor necrosis factor‐α ; WT, wild‐type