Inhibition of Antiviral Innate Immunity by Avibirnavirus VP3 via Blocking TBK1-TRAF3 Complex Formation and IRF3 Activation

Figures

• 

  FIG 1. Avibirnavirus VP3 protein suppresses MDA5-mediated IFN-β activation. (A and B) Replication of IBDV strain NB in HEK293T cells. HEK293T cells were infected with IBDV NB at an MOI of 10 for the indicated times. (A) The expression levels of viral proteins were detected with the indicated viral protein antibodies. IB, immunoblotting. (B) At 12 h after IBDV infection, cells were subjected to an immunofluorescence staining assay with anti-VP3 mouse MAb. (C) Kinetics of IBDV NB replication in HEK293T cells. HEK293T cells were infected with IBDV at an MOI of 10. At different time points (8, 12, 16, 20, and 72 h) after IBDV infection, the viral titers in the cell cultures were harvested, and the TCID50 was calculated. (D and E) VP3 represses IFN-β promoter activity. Luc, luciferase; Vec., vector. (E and F) KEK293T cells were cotransfected with the IFN-β reporter and the pRL-TK and VP3 plasmids (100 ng, 200 ng, 300 ng, 500 ng) along with MDA5 (E) or RIG-I (F) for 36 h. Luciferase activity was then detected by a dual-luciferase assay. ns, not significant. (F) Viral protein VP3 knockdown contributes to the induction of IFN-β by IBDV. DF-1 cells were infected with IBDV at an MOI of 10. At 1 h…

• 

  FIG 2. VP3 blocks IFN-β production by inhibiting the activation of IRF3. (A and B) Inhibition of MDA5 (A)- or SeV (B)-mediated IRF3 promoter activation by Avibirnavirus VP3. Dual-luciferase assays were performed as described for Fig. 1A and B. (C and D) HEK293T cells were transfected with the expression plasmid of VP3 or an empty vector and with or without MDA5 for 36 h. Cells were then harvested. The levels of IRF3 dimers were subjected to IRF3 dimer gels (C), and the levels of p-IRF3 and total IRF3 in the cytoplasmic and nuclear fractions were subjected to Western blotting (D). GAPDH and LaminB1 were used as the cytoplasmic and nuclear fraction markers, respectively. Mono, monomer; WCL, whole-cell lysates; Cyto, cytoplasm. (E) Impact of VP3 knockdown on IBDV-driven IRF3 activation. HEK293T cells were infected with IBDV at an MOI of 10 for 1 h, and the RNAi sequence (GACGAAGUUGCCAAAGUCUAU) against VP3 was transfected into the resultant cells for another 23 h. The lysates were subjected to an immunoblotting assay with the indicated antibodies. Si-VP3, viral protein VP3 knockdown. (F) Effects of VP3 on MDA5-induced IFN-β production. HEK293T cells were transfected with VP3 or an empty…

• 

  FIG 3. The CC1 domain of VP3 is required for downregulating IFN-β production by interacting with TRAF3. (A) Effects of VP3 on the components of the RLR signaling pathway. HEK293T cells were transfected with the IFN-β reporter, pRL-TK, and an empty vector, MDA5, MAVS, TBK1, or IRF3(5D) along with a control vector or a vector expressing VP3 for 36 h; the IFN-β activities were then measured using a dual-luciferase assay. (B) Identification of the interaction of VP3 with RLR pathway molecules. Flag-tagged MDA5, MAVS, TBK1, IRF3, or TRAF3 and Myc-VP3 were cotransfected into HEK293T cells for 48 h. The lysates were subjected to a Co-IP assay with anti-Flag mouse MAb and immunoblotting with anti-Flag and anti-Myc rabbit PAb. (C) Endogenous TRAF3 colocalization with VP3 during IBDV infection. DF-1 cells were infected with IBDV and were subjected to immunofluorescence staining with anti-TRAF3 rabbit PAb and anti-VP3 mouse MAb. (D and E) Avibirnavirus VP3 interacts with endogenous TRAF3 during IBDV infection. HEK293T cells were infected with IBDV (MOI = 10) for 12 h, and cellular lysates were subjected to a Co-IP assay with anti-VP3 mouse MAb (D) or anti-TRAF3 rabbit PAb (E). Anti-IgG mouse or…

• 

  FIG 4. The residue lysine-155 of TRAF3 is necessary for VP3 to downregulate IFN-β production. (A) Schematic representation of different domains of TRAF3 and its deletion mutants. aa, amino acids. (B) Identification of the TRAF3 domain binding to Avibirnavirus VP3. HEK293T cells were cotransfected with VP3 and Flag-tagged TRAF3, TRAF3△RING, TRAF3△zinc finger, or TRAF3△TRAF-C for 48 h. Cellular lysates were subjected to a Co-IP assay with anti-Flag mouse MAb and an immunoblotting assay using anti-Flag and anti-Myc rabbit PAbs. (C) The zinc finger domain of TRAF3 is essential for the interaction with VP3. A zinc finger fragment was cloned into the eGFP-C3 vector, and then the resulting construct and vector encoding Avibirnavirus VP3 were cotransfected into HEK293T cells for 48 h. Cellular lysates were subjected to a Co-IP assay with anti-VP3 mouse MAb and an immunoblotting assay with anti-GFP and anti-VP3 mouse MAbs. (D) Residual sequence of the zinc finger domain of TRAF3. The lysine residues are displayed in boldface. (E) The residue lysine-155 of TRAF3 is crucial for the interaction with VP3. Different Flag-TRAF3 mutants bearing a single lysine (K)-to-arginine (R) substitution and…

• 

  FIG 5. VP3 decreases the interaction of TRAF3 with TBK1 by inhibiting K33-linked polyubiquitination of the residue lysine-155 of TRAF3. (A) IBDV infection suppresses the ubiquitination of TRAF3. HEK293T cells were cotransfected with Flag-TRAF3 and HA-Ub or the corresponding empty vector for 24 h. The resultant cells were infected with IBDV for another 24 h. The lysates were subjected to immunoprecipitation and Western blotting assays with the indicated antibodies. (B) Viral protein VP3 represses TRAF3 ubiquitination. HEK293T cells were cotransfected with HA-Ub and Flag-TRAF3 along with an empty vector or Myc-VP3 for 48 h. Cellular lysates were subjected to a ubiquitination assay with anti-Flag mouse MAb and an immunoblotting assay using anti-HA mouse MAb and anti-Flag and anti-Myc rabbit PAbs. (C) Identification of the ubiquitination phenotype of the residue lysine-155 of TRAF3. Flag-TRAF3-WT or Flag-TRAF3-K155R and different HA-Ub mutants were cotransfected into HEK293T cells for 48 h. Cell lysates were subjected to a ubiquitination assay with anti-Flag mouse MAb and a Western blotting assay using anti-Flag rabbit PAb and anti-HA mouse MAb. (D) K33-linked ubiquitin chains enhance the…