Integrative taxonomic confirmation of five nationally significant lichenized fungi from gökçeada (Çanakkale, Türkiye) based on its rDNA phylogeny

Background Gökçeada (Çanakkale, Türkiye) contains a diverse mosaic of coastal and inland habitats that can harbor overlooked lichen diversity. In the doctoral survey conducted on the island, lichen specimens were identified by integrating classical morphology/anatomy and spot-test chemistry with ITS rDNA barcoding and phylogenetic analyses. Methods From the study area, five lichenized fungal species of particular national significance were documented and evaluated in detail. Molecular verification was performed for these taxa using ITS rDNA amplification with the ITS1F/ITS4 primer pair, followed by BLAST comparison against GenBank sequences and phylogenetic reconstruction. Phylogenetic analyses were conducted primarily using the Neighbor-Joining method and additionally confirmed with Maximum Likelihood inference under Kimura-2-parameter distances, ensuring congruence between morphological identification and molecular placement. Three species—Polyozosia schofieldii, Rhizocarpon atroflavescens and Toninia talparum—were reported from Türkiye for the first time, whereas Circinaria mansourii and Lecidella flavosorediata were confirmed as second national records. Results The results are synthesized as a manuscript emphasizing these five taxa, including brief diagnostic descriptions, ecology, and ITS-based phylogenetic support with figure citations for later insertion. Gökçeada (Çanakkale, Türkiye) harbors diverse habitats that may support overlooked lichen diversity. In this study, five lichenized fungal species of national significance were investigated using an integrative taxonomic approach combining morphology, anatomy, chemistry, and ITS rDNA phylogeny. In this study ITS1F (CTTGGTCATTTAGAGAAGTAA) and ITS4. TCCTCCGCTTATTGATATGC was used as primary pair. PCR programme was carried out as pre denaturation at 95 oC for 5 min., cycle amplification step at, 94 oC 30 sec., 55 oC 30 sec., 72 oC 1min 35, and the last extension step was carried out at 72 oC 8 min. Phylogenetic analyses were performed using Neighbor-Joining (NJ) and Maximum Likelihood (ML) methods under the Kimura-2-parameter model, with bootstrap support values based on 1000 replicates. Conclusion All studied specimens clustered with their respective reference sequences with strong statistical support (bootstrap values ranging from ~85% to 100%), confirming their taxonomic identities. Three species—Polyozosia schofieldii, Rhizocarpon atroflavescens, and Toninia talparum—are reported as new records for Türkiye, while Circinaria mansourii and Lecidella flavosorediata represent second national records. These findings highlight the importance of integrative approaches in uncovering hidden biodiversity and refining the lichen biota of Turkey.