First Report of Meloidogyne graminicola Infecting Monochoria vaginalis in China

Monochoria vaginalis is a serious weed in rice paddies, which is harvested as a vegetable crop, an ornamental, a forage plant and a plant for local medicinal use. In the summer of 2024, when weeding a rice breeding experimental field located at [Latitude: 23°02′53″N, Longitude: 108°19′22″E] in Wuming District, Guangxi, China, root-knot nematodes (RKNs) were found, with galls prevalent in the roots of M. vaginalis and the plants exhibiting symptoms of stunted growth and reduced vigor. Females and eggs were observed in dissected root-knots under a microscope. Morphological measurements of females (n = 20) included body length (L) = 545.3 ± 51.6 (462.2 to 628.4) μm; body width (BW) = 371.5 ± 35.9 (298.6 to 438.4) μm; stylet = 12.2 ± 1.2 (9.4 to 14.1) μm; dorsal pharyngeal gland orifice to stylet base (DGO) = 4.2 ± 0.4 (3.5 to 4.8) μm. The perineal patterns of females were dorsoventrally oval-shaped with low and round dorsal arches, a few well-marked, irregular, short, zig-zag striae, and indistinct lateral lines. Measurements of second-stage juveniles (J2s) (n = 20) were L = 467.9 ± 17.9 (432.5 to 501.2) μm; BW = 21.5 ± 2.1 (17.8 to 25.1) μm; stylet = 13.7 ± 0.6 (12.5 to 14.8) μm; DGO = 3.4 ± 0.3 (2.8 to 4.1) μm; tail = 72.8 ± 3.4 (68.7 to 80.6) μm; hyaline tail length = 19.7 ± 1.9 (16.5 to 22.8) μm. The J2s were vermiform and had a long and slender tail with a tapering hyaline tail terminus. These morphological features closely resemble the previously described characteristics of Meloidogyne graminicola (Golden and Birchfield. 1965). Individual J2s (n = 3) DNA was further explored using the primers 18S/26S (Vrain et al. 1992), C2F3/1108 (Powers and Harris. 1993), and Cox1F/Cox1R (Trinh et al. 2019). Three fragments (790 bp [GenBank accession no. PQ345083], 531 bp [PQ456744], and 413 bp [PQ350374]) were amplified and had 100% sequence homology with M. graminicola (MG773553.1, KY020413.1, and MN017128.1, respectively). The species-specific primers Mg-F3/Mg-R2 (TTATCGCATCATTTTATTTG/CGCTTTGTTAGAAAATGACCCT) were used to amplify the internal transcribed spacer (ITS) region (Htay et al. 2016), that an expected PCR fragment of approximately 369 bp was obtained. Therefore, the unknown nematode was further identified as M. graminicola. For the pathogenicity test, 10 four-leaf stage M. vaginalis seedlings planted in pots with sterilized sandy soil were inoculated with 500 freshly hatched J2s/pot from the original population, and noninoculated seedlings (n=10) were used as controls. All plants were grown in an illuminating incubator at 28°C with a 12 h light/12 h dark photoperiod. After 7 weeks, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 17.8 ± 2.3. No galls were observed on noninoculated plants. These results confirmed the pathogenicity of M. graminicola on M. vaginalis. Although the early literature mentioned that the plant was a host for M. graminicola, this was not confirmed (Bridge et al. 2005). To our knowledge, this is the first report of a natural infection of M. graminicola on M. vaginalis in China. As an annual herb with a well-developed root system, M. vaginalis supports a high population density of nematodes. Our study showed the nematode's rapid population growth on this plant, severely threatening rice production. Thus, promptly controlling M. vaginalis is essential for ecological management of M. graminicola, ensuring the protection of crop yields.