First report of grapevine virus B in muscadine grape ( Muscadinia rotundifolia (Michx.) Small) in Florida

Grapevine virus B has been reported previously from muscadine in the United States, but not molecularly confirmed in Florida. In May and July 2024, petiole tissues were collected from asymptomatic muscadine grapevines (Muscadinia rotundifolia (Michx.) Small) in Leon County, Florida. Initial screening of 60 vines with published RT-PCR and RT-qPCR assays for grapevine virus B (GVB) yielded no detectable amplification (Osman and Rowhani 2008; Osman et al. 2013; Sabanadzovic and Aboughanem-Sabanadzovic 2016). During later field evaluation in a different vineyard block, mature vines showed symptoms consistent with the rugose wood disease complex. Because the symptomatic mother vine was linked by propagation to screened ‘Carlos’ progeny among the initial 60 samples, follow-up sampling targeted that mother vine, associated progeny, and material from ‘Welder’ and three fresh-fruit cultivars. To characterize viruses present in symptomatic and propagation-linked material and to determine whether divergent GVB variants had escaped detection by existing assays, nine individual follow-up samples were analyzed by high-throughput sequencing (HTS) with no pooling. Total RNA was extracted using a MagMAX Plant RNA Isolation Kit (Thermo Fisher Scientific, Waltham, MA), and libraries were prepared with a TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina, San Diego, CA). Libraries were sequenced on an Illumina platform to a minimum depth of 15 million 75-bp reads. Reads were demultiplexed, adapter trimmed, host screened, de novo assembled with SPAdes 14.0, and annotated by BLAST as described by Stevens and Al Rwahnih (2024). HTS detected GVB alone in ‘Welder’ and one fresh-fruit cultivar, GVB with grapevine leafroll-associated virus 2 (GLRaV-2) in four ‘Carlos’ samples, GLRaV-2 alone in one fresh-fruit cultivar, hop stunt viroid (HSVd) in one additional ‘Carlos’ sample, and no virus in a third fresh-fruit cultivar. De novo assembly of 20.1 million reads from one ‘Carlos’ sample produced a 7,575-bp contig representing a nearly complete genome of a divergent grapevine virus B isolate. BLASTn analysis indicated that the closest match was MN716773.1, with 6,365/7,576 bp identical (84% identity) (Hu et al. 2021). HTS-derived consensus sequences were used to design a new endpoint RT-PCR assay to detect the divergent GVB variant identified in this study, with primers GVB_F_VC (CATGGAAAATATATCCCGGATG) and GVB_R_VC (CATAGAAATCAGGGATAGACTAT). Amplification was performed at 95°C for 2 min; 39 cycles of 95°C for 20 s, 52°C for 20 s, and 72°C for 40 s; followed by 72°C for 5 min. The assay produced the expected 1,033-bp amplicon, which was confirmed by Sanger sequencing. Sequence comparison identified nucleotide mismatches in published primer/probe target regions, consistent with the earlier assays’ failure to detect the divergent variant. Using the HTS-informed assay, GVB was detected in 11 of 60 previously screened vines (18%). Sanger sequencing confirmed five detections, including four ‘Carlos’ vines and one ‘Welder’ vine. GLRaV-2 coinfection was confirmed in three of the five Sanger-confirmed GVB-positive vines by RT-qPCR using the assay of Klaassen et al. (2010). Negative controls included a no-template control and a virus-negative sample. Sequences generated in this study were deposited in GenBank under accession numbers PZ282014-PZ282019. To our knowledge, this study provides the first molecular confirmation of GVB in muscadine grape in Florida and indicates that locally divergent variants can escape detection by published assays, underscoring the need for sequence-informed diagnostics in muscadine propagation and testing programs and in Florida production systems.