High Gene Expression of MDR1 (ABCB1) is Associated with Medical Treatment Response and Long-Term Remission in Patients with Ulcerative Colitis

To the Editor: The multidrug resistant gene 1 (MDR1), also known as ABCB1, is the first member of the ATP binding cassette family (ABC) proteins. MDR1 is expressed in hepatocytes, enterocytes, brain blood capillaries, ovaries, and testes cells as well as peripheral blood mononuclear cells and macrophage.1 The relevance of MDR1 gene in inflammatory bowel disease (IBD) is based on data provided from Mdr1a−/− knockout mice that spontaneously develop colitis around 12 weeks of age.2 MDR1 expression in the intestinal tract has an important role in the pharmacokinetics of drugs used in ulcerative colitis (UC) treatment such as corticosteroids, which have been associated with drug resistance.3 Polymorphisms of the MDR1 gene have been associated with refractory Crohn's disease (CD) and UC.4 A previous study has reported low expression of MDR1 in inflamed mucosa in patients with UC.5 However, this is the first study to the best of our knowledge with a larger sample that explores an association between MDR1 expression in biopsies from rectum and clinical outcomes such as medical treatment response and long-term remission in patients with UC. We measured the MDR1 gene expression from rectum biopsies of UC patients from December 2006 to July 2008. All individuals were divided into 3 groups: 1) active UC (n = 21); 2) long-term UC remission (n = 21); and 3) normal control group (n = 20). Expression of mRNA MDR1 (ABCB1) and IL-6 were measured by real-time polymerase chain reaction (RT-PCR). The following primers were used: MDR1 forward: acagaaagcgaagcatggt and reverse: atggtggtccgaccttttc; IL-6 forward: tctgctcccacaatgaaacat and reverse: gatgcccagggaagacag, as well as RPLP0 forward: acagaaagcgaagcatggt, reverse: atggtggtccgaccttttc for normalization. Medical response was defined as induction and maintenance of remission with treatment based on mesalazine (3–4.5 g/day), or oral prednisone 0.5–0.7 mg/kg/day and azathioprine 2–2.5 mg/kg/day. Long-term remission was the absence of activity by clinical, endoscopic, and histological criteria for at least 2 years according to Mayo and Riley scores, respectively. These results showed that MDR1 expression was decreased in patients with active UC compared to UC patients in remission and the normal control group (P = 0.034 and P = 0.002, respectively). The MDR1 levels were decreased in UC remission compared to the normal control group (P = 0.04) (Fig. 1). The IL-6 gene expression was increased in patients with active UC compared to UC in remission and the normal control group (P = 0.001). The medical treatment response and long-term remission were associated with high gene expression of MDR1 (P = 0.009 and P = 0.002, respectively) as shown in Table 1. MDR1 mRNA expression is decreased in patients with UC as compared to normal controls. The MDR1 expression is also decreased in patients with active and the inflamed control group compared with normal controls. Association Between Clinical Characteristics and MDR1 Gene Expression in Patients with UC (N=42) Association Between Clinical Characteristics and MDR1 Gene Expression in Patients with UC (N=42) We also found that MDR1 gene expression oppositely correlated with IL-6 expression, which was used as an inflammatory marker in order to confirm endoscopic and histologic criteria (r2 = −0.375 P = 0.013) by Spearman correlation test. We also measured the gene expression of MDR1 from 6 different intestinal regions (cecum to rectum) in all patients with UC and normal controls paired by gender and age, confirming these findings through all intestinal regions. These findings confirmed the potential role of the MDR1 gene in the pathogenesis of UC and suggest that MDR1 gene expression from rectum biopsies could be used as a potential marker to predict the clinical course and outcome in patients with UC. In conclusion, high gene expression of MDR1 was associated with medical treatment response and long-term remission in UC.