Arp2/3 complex-dependent actin remodeling is required for efficient RSV uncoating in A549 cells

Figures

• 

  Fig 1. Arp2 knockout impedes RSV infection in A549 cells at both early and late stages. (A) sgRNA (single-guide RNA) target site within the ARP2 (actin-related protein 2) locus. Schematic representation of the ARP2 gene showing exons as numbered boxes (Ex1–Ex9). The protospacer (TCATTCCAGTTTGTGAAGTG) is shown in blue, and the PAM (protospacer adjacent motif; TGG) is shown in green. (B) Immunoblot analysis of Arp2 in A549 WT (wild-type) and Arp2 KO (knockout) cells. HSC70 (heat shock cognate 71 kDa protein) served as a loading control. (C) Representative images of RSV-GFP (MOI = 3) infected or mock-infected A549 WT and Arp2 KO17 cells at 24 h p.i.. Images were acquired on an Incucyte automated microscope using a 4× objective. Infected cells were green due to GFP expression. Merged phase-contrast and GFP images are shown. Scale bar, 200 µm. (D) Flow cytometry analysis of RSV-GFP infection at 8 and 12 h p.i. in A549 WT cells and two Arp2 KO cell clones (MOI = 4). Data from three independent experiments (mean ± SD; n = 3 biological replicates). Each dot represents the mean value of one experiment. ****P < 0.0001 (two-way ANOVA). (E) Representative fluorescence images of RSV-GFP (MOI = 0.2)…

• 

  Fig 2. Arp2 re-expression restores actin remodeling and rescues RSV infection in Arp2 KO cells. (A) Schematic of the lentiviral transfer plasmids. For the mScarlet3-P2A-Arp2 cassette, a P2A sequence was incorporated to enable bicistronic expression of separate mScarlet3 and Arp2 proteins. (B) Immunoblot analysis of Arp2 expression in untransduced or lentivirus-transduced A549 WT and Arp2 KO cells. Arp2 expression was restored by transducing with lentivirus carrying a bicistronic mScarlet3-P2A-Arp2 expression cassette. Cells transduced with lentivirus carrying mScarlet3 alone were used as controls. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as loading control. (C) Representative spinning-disk confocal microscopy images of cells overexpressing Myc-Rac1(Q61L). Cells were transfected with pRK5-Myc-Rac1(Q61L), fixed, permeabilized, and stained with anti-Myc antibodies (green), Alexa Fluor 647-conjugated phalloidin (pseudocolor gray), and Hoechst 33342 (pseudocolor magenta). Images are shown as maximum-intensity projections. Scale bar, 10 µm. Blue arrows point to representative lamellipodia and membrane ruffles. (D) Quantification of cells displaying membrane ruffles after…

• 

  Fig 3. RSV attachment and cell receptor dynamics are unaffected in Arp2 KO cells. (A) Representative confocal microscopy images of RSV-GFP (MOI = 1) bound to A549 WT and Arp2 KO17 cells. Cells were incubated with virus or mock-infected for 1 h on ice, washed to remove unbound virus, fixed, and stained with Palivizumab (anti-RSV-fusion protein, in pseudocolor cyan), Hoechst 33342 (cell nuclei, in pseudocolor green), and WGA (wheat germ agglutinin-Alexa Fluor 647, magenta). Images were acquired on a spinning-disk microscope and are shown as maximum-intensity projections. Scale bar, 50 µm. (B) Quantification of viral binding from the image series in panel A. Pooled data of three individual experiments (three biological replicates per experiment). n denotes the number of cells analyzed. Experiments are color-coded; each dot represents one image, and each rectangle represents the experiment mean. Mean ± SD. ns, not significant (two-way ANOVA). (C) Immunoblot of endogenous IGF1R and nucleolin in A549 WT and Arp2 KO cells. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) served as loading control. (D) Schematic of using PALM in combination with TIRF to assess IGF1R diffusion and clustering.…

• 

  Fig 4. Arp2 knockout affects macropinocytic dextran uptake but not RSV internalization. (A) Representative confocal microscopy images showing uptake of 70 kDa fluorescein-labeled dextran in A549 WT and Arp2 KO cells. Cells were incubated with 0.6 mg/mL dextran for 15 min. Cells were fixed and stained with Hoechst 33342 (shown in pseudocolor gray). Images were acquired on a spinning-disk confocal microscope and are shown as maximum-intensity projections. Scale bar, 20 µm. (B) Quantification of dextran uptake from the image series in panel A. Data are from four independent experiments (three biological replicates per experiment). n denotes the number of cells analyzed. Experiments are color-coded; each dot represents one image, and each triangle indicates the experiment mean. Bars show mean ± SD across experiments. ns, **P < 0.01; ****P < 0.0001 (two-way ANOVA). a.u., arbitrary units. (C) RT-qPCR results of entry-assay with on ice preincubation. Cells were incubated with RSV (MOI = 5) on ice for 1 h; unbound virus was removed by washing. Cells were shifted to 37°C for 30 or 60 min, then treated with trypsin before RNA extraction and RT-qPCR. RSV nucleoprotein RNA was quantified relative…

• 

  Fig 5. Arp2 knockout impedes RSV F-mediated VLP uncoating and limits RSV transcription. (A) Schematic of using VLP-BlaM to assess RSV uncoating. VLPs were generated using a SARS-CoV-2-based VLP system (41) bearing the RSV fusion protein instead of Spike, and was applied to A549 WT or Arp2 KO cells. Cytosolic BlaM activity was assessed using CCF2-AM, a FRET-based substance. This image was created using Biorender (license number HC29AQJKBO). (B) Arp2 KO impeded RSV F-mediated uncoating. Cells were infected with VLPs or mock infected at 37°C for 2 h, then incubated with CCF2-AM in the dark at RT for 3 h. Cells were detached, fixed in PFA, and analyzed using flow cytometry. The percentage of BlaM-positive cells was normalized per experiment to A549 WT. Data are from three independent experiments (n = 3 biological replications). Mean ± SD. ****P < 0.0001 (two-way ANOVA with Dunnett’s multiple comparisons test). (C) Arp2 KO reduced RSV transcription. RT-qPCR time course of RSV gene expression following infection (RSV-GFP, MOI = 0.5) in A549 WT versus Arp2 KO cells. RSV non-structural protein 1 (NS1), non-structural protein 2 (NS2), and nucleoprotein (N) transcripts were quantified and…