Regulation of Vascular Tone in Animals Overexpressing the Sarcolemmal Calcium Pump

The mechanisms governing vascular smooth muscle tone are incompletely understood. In particular, the role of the sarcolemmal calcium pump PMCA (plasma membrane calmodulin-dependent calcium ATPase), which extrudes Ca2+ from the cytosol, and its importance compared with the sodium/calcium exchanger remain speculative. To test whether the PMCA is a regulator of vascular tone, we generated transgenic mice overexpressing the human PMCA4b under control of the arterial smooth muscle-specific SM22α promoter. This resulted in an elevated systolic blood pressure compared with littermate controls. In PMCA-overexpressing mice, endothelium-dependent relaxation of norepinephrine-preconstricted aortic rings to acetylcholine did not differ from wild type controls (76 ± 8% versus 79 ± 8% of maximum relaxation; n = 12, n.s.). De-endothelialized aortas of transgenic mice exhibited stronger maximum contraction to KCl (100 mmol/liter) compared with controls (86 ± 6% versus 68 ± 7% of reference KCl contraction at the beginning of the experiment; p <0.05). Preincubation of de-endothelialized vessels with the nitric oxide synthase (NOS) inhibitor l-NAME (l-N(G)-nitroarginine methyl ester) (10–5 mol/liter) resulted in a stronger contraction to KCl (p <0.05 versus without l-NAME), thus unmasking vasodilatory effects of inherent NO production. Maximum contraction to KCl after preincubation with l-NAME did not differ between PMCA mice and controls. In analogy to the results in PMCA-overexpressing mice, contractions of de-endothelialized aortas of neuronal NOS-deficient mice to KCl were significantly increased compared with controls (151 ± 5% versus 131 ± 6% of reference KCl contraction; p <0.05). In conclusion, our data suggest a model in which the sarcolemmal Ca2+ pump down-regulates activity of the vascular smooth muscle Ca2+/calmodulin-dependent neuronal NOS by a functionally relevant interaction. Therefore, the PMCA represents a novel regulator of vascular tone. The mechanisms governing vascular smooth muscle tone are incompletely understood. In particular, the role of the sarcolemmal calcium pump PMCA (plasma membrane calmodulin-dependent calcium ATPase), which extrudes Ca2+ from the cytosol, and its importance compared with the sodium/calcium exchanger remain speculative. To test whether the PMCA is a regulator of vascular tone, we generated transgenic mice overexpressing the human PMCA4b under control of the arterial smooth muscle-specific SM22α promoter. This resulted in an elevated systolic blood pressure compared with littermate controls. In PMCA-overexpressing mice, endothelium-dependent relaxation of norepinephrine-preconstricted aortic rings to acetylcholine did not differ from wild type controls (76 ± 8% versus 79 ± 8% of maximum relaxation; n = 12, n.s.). De-endothelialized aortas of transgenic mice exhibited stronger maximum contraction to KCl (100 mmol/liter) compared with controls (86 ± 6% versus 68 ± 7% of reference KCl contraction at the beginning of the experiment; p <0.05). Preincubation of de-endothelialized vessels with the nitric oxide synthase (NOS) inhibitor l-NAME (l-N(G)-nitroarginine methyl ester) (10–5 mol/liter) resulted in a stronger contraction to KCl (p <0.05 versus without l-NAME), thus unmasking vasodilatory effects of inherent NO production. Maximum contraction to KCl after preincubation with l-NAME did not differ between PMCA mice and controls. In analogy to the results in PMCA-overexpressing mice, contractions of de-endothelialized aortas of neuronal NOS-deficient mice to KCl were significantly increased compared with controls (151 ± 5% versus 131 ± 6% of reference KCl contraction; p <0.05). In conclusion, our data suggest a model in which the sarcolemmal Ca2+ pump down-regulates activity of the vascular smooth muscle Ca2+/calmodulin-dependent neuronal NOS by a functionally relevant interaction. Therefore, the PMCA represents a novel regulator of vascular tone. The epidemic of cardiovascular disease has led to a particular interest in the mechanisms governing contraction of the vasculature that determine the height of blood pressure in physiological adaptation (e.g. exercise) and in pathological states such as hypertension and heart failure. The contractile state of vascular smooth muscle cells is determined by tonic and phasic contractions brought about by a complex interplay of myosin light chain phosphorylation and intracellular calcium (reviewed in Refs. 1Pfitzer G. J. Appl. Physiol. 2001; 91: 497-503Crossref PubMed Scopus (263) Google Scholar and 2Jaggar J.H. Wellman G.C. Heppner T.J. Porter V.A. Perez G.J. Gollasch M. Kleppisch T. Rubart M. Stevenson A.S. Lederer W.J. Knot H.J. Bonev A.D. Nelson M.T. Acta. Physiol. Scand. 1998; 164: 577-587Crossref PubMed Scopus (258) Google Scholar). Outward calcium transport across the plasma membrane is maintained by two transport systems, the Na+/Ca2+ exchanger and the plasma membrane calmodulin-dependent calcium ATPase (PMCA). 1The abbreviations used are: PMCA, plasma membrane calmodulin-dependent calcium ATPase; NOS, nitric oxide synthase; nNOS, neuronal NOS; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate; l-NAME, l-N(G) nitroarginine methyl ester; n.s., not significant; SM, smooth muscle. The Na+/Ca2+ exchanger has high and the PMCA relatively low capacity for calcium transport. Initially, it had been assumed that the exchanger has much lower Ca2+ affinity than the PMCA, but this has been disputed (pump properties are summarized in Refs. 3Carafoli E. Physiol. Rev. 1991; 71: 129-153Crossref PubMed Scopus (582) Google Scholar, 4Carafoli E. Annu. Rev. Physiol. 1991; 53: 531-547Crossref PubMed Scopus (131) Google Scholar, 5Strehler E.E. Semin. Cell Biol. 1990; 1: 283-295PubMed Google Scholar). Hence, the physiological role of the PMCA in excitable tissues that express relatively high amounts of exchanger protein has remained somewhat unclear. Four isoforms of the pump have been described, two of which (i.e. 1 and 4) are prominently expressed in peripheral extraneuronal tissues. The PMCA itself has also been shown to be a target for post-translational modifications, e.g. phosphorylation by protein kinase A or focal adhesion kinase, influencing the activity of the pump (6Neyses L. Reinlib L. Carafoli E. J. Biol. Chem. 1985; 260: 10283-10287Abstract Full Text PDF PubMed Google Scholar, 7Dean W.L. Chen D. Brandt P.C. Vanaman T.C. J. Biol. Chem. 1997; 272: 15113-15119Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 8Wan T.C. Zabe M. Dean W.L. Thromb. Haemostasis. 2003; 89: 122-131Crossref PubMed Scopus (30) Google Scholar). Additionally, it was suggested that the plasma membrane Ca2+ pump itself may be regulated by cyclic GMP and protein kinase C in vascular smooth muscle cells (9Furukawa K. Tawada Y. Shigekawa M. J. Biol. Chem. 1989; 264: 4844-4849Abstract Full Text PDF PubMed Google Scholar, 10Furukawa K. Tawada Y. Shigekawa M. J. Biol. Chem. 1988; 263: 8058-8065Abstract Full Text PDF PubMed Google Scholar). In an attempt to define the role of the PMCA in smooth muscle cell proliferation, Husain et al. (11Husain M. Jiang L. See V. Bein K. Simons M. Alper S.L. Rosenberg R.D. Am. J. Physiol. 1997; 272: C1947-C1959Crossref PubMed Google Scholar) observed regulation of PMCA1 and PMCA4 mRNA transcription during cell cycle progression in vascular smooth muscle cells and showed that transient PMCA overexpression reduces the cell proliferation rate more than 2.5-fold. In recent years, our group has developed the hypothesis that the PMCA in skeletal and heart muscle plays a more significant role in signal transduction than in regulation of calcium subserving contraction/excitation coupling (12Hammes A. Oberdorf-Maass S. Rother T. Nething K. Gollnick F. Linz K.W. Meyer R. Hu K. Han H. Gaudron P. Ertl G. Hoffmann S. Ganten U. Vetter R. Schuh K. Benkwitz C. Zimmer H.G. Neyses L. Circ. Res. 1998; 83: 877-888Crossref PubMed Scopus (87) Google Scholar). Recently, a specific mechanism by which isoform 4b (also termed 4CI) of the pump exerts a regulatory role has been identified. PMCA4b has a C-terminal ligand for PDZ domains (13Kim E. DeMarco S.J. Marfatia S.M. Chishti A.H. Sheng M. Strehler E.E. J. Biol. Chem. 1998; 273: 1591-1595Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 14DeMarco S.J. Chicka M.C. Strehler E.E. J. Biol. Chem. 2002; 277: 10506-10511Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 15DeMarco S.J. Strehler E.E. J. Biol. Chem. 2001; 276: 21594-21600Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar), and we have shown that it forms a physical complex with nitric oxide synthase I (neuronal (n)NOS) and tightly regulates NO production from this (but not the endothelial) NOS isoform (16Schuh K. Uldrijan S. Telkamp M. Rothlein N. Neyses L. J. Cell Biol. 2001; 155: 201-206Crossref PubMed Scopus (134) Google Scholar). In the present work, using transgenic overexpression of PMCA4b under the control of the highly vascular-specific SM22 α promoter (17Solway J. Seltzer J. Samaha F.F. Kim S. Alger L.E. Niu Q. Morrisey E.E. Ip H.S. Parmacek M.S. J. Biol. Chem. 1995; 270: 13460-13469Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar), we begin to define the role of the PMCA in the regulation of vascular smooth muscle cell tone. In integrated physiological systems, vascular tone translates into blood pressure, and it was therefore of particular interest to investigate whether the PMCA might be a potential candidate for blood pressure regulation. Generation of PMCA4b Transgenic Mice—To generate transgenic mice, the smooth muscle-specific SM22α promoter (Ref. 17Solway J. Seltzer J. Samaha F.F. Kim S. Alger L.E. Niu Q. Morrisey E.E. Ip H.S. Parmacek M.S. J. Biol. Chem. 1995; 270: 13460-13469Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar; a kind gift from M. S. Parmacek, Department of Medicine, University of Pennsylvania, Philadelphia, PA) was cloned into a vector backbone containing the human PMCA4b cDNA (accession number NM_001684) and an SV40 polyadenylation signal, as described before (12Hammes A. Oberdorf-Maass S. Rother T. Nething K. Gollnick F. Linz K.W. Meyer R. Hu K. Han H. Gaudron P. Ertl G. Hoffmann S. Ganten U. Vetter R. Schuh K. Benkwitz C. Zimmer H.G. Neyses L. Circ. Res. 1998; 83: 877-888Crossref PubMed Scopus (87) Google Scholar). Six transgenic founders were obtained after standard pronucleus injection procedure; five of them gave rise to transgenic strains expressing the hPMCA4b in various artery smooth muscles of different organs. The cell line 1505.5, showing the most ubiquitous expression in smooth muscles of the vascular system, and non-transgenic littermates were used for this study. nNOS knock-out mice B6129S-Nos1tm1Plh and the appropriate controls B6129SF2/J (“nNOS controls”) were obtained from The Jackson Laboratory, Bar Harbor, Maine. The study design and the experimental protocols were conducted according to the local institutional guidelines for the care and use of laboratory animals and are in accordance with the American Heart Association guidelines for research animal use. Verification of Transgene Integration and Maintenance of Transgenic Lines—Integration of the used construct was verified by Southern blotting and PCR assays using tail biopsy samples. For Southern blotting assays, the human PMCA4b cDNA was used as probe. For routine use, the following human PMCA4b-specific primers were used in standard PCR assays: forward, GGCTCCCTGAGTGTACTCCC; reverse, CCTGATGACGGTGCTCATTG. Offspring of founders were mated to C57Bl/6 mice. Experiments were done after >4 inbred generations to C57Bl/6 background. To avoid possible insertion effects of the transgene, only transgenic mice and their littermates were used for these experiments. Verification of Transgene Expression—Expression of transgene was tested on the mRNA level by RT-PCR and on the protein level by Western blotting and immunohistological staining. Interaction of PMCA4b with nNOS was verified by co-immunoprecipitation and subsequent Western blotting. RT-PCR was done using 2 μg of total RNA of the corresponding organ in standard reactions using the manufacturer's protocol (Qiagen one-step RT-PCR kit, Qiagen) and the hPMCA4b-specific primers (see above). Expression of PMCA4b in aorta and interaction of nNOS with PMCA4 were detected by precipitation of PMCA4b-containing complexes and subsequent Western blotting. In brief, aortas of four transgenic and four control mice were pooled, lysed in RIPA buffer (PBS containing 1% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS) by Dounce homogenization. After sedimentation of cellular debris and an initial preclearing step, aorta lysates containing 300 μg of protein were incubated with 5 μl of anti-PMCA4 serum (SWANT) or 5 μg of monoclonal mouse anti-human PMCA4b antibody (clone JA3; Neomarkers) or 5 μg of irrelevant antibodies for 1 at complexes were with a of μl of protein and in After the were with RIPA with in by 8% and to a were with 5% in (PBS with and incubated for 1 at with antibodies anti-PMCA4 monoclonal number After four with were incubated with antibodies for 1 and with were detected with the To expression of transgenic human PMCA4b in smooth muscle cells of the cardiovascular in mice, we used a a of the of human PMCA4 in vascular smooth muscle cells of wild type mice was with a with mouse D. Carafoli E. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). To for nNOS in mouse smooth muscle we used the number were according to Am. J. Physiol. 277: Google After in were incubated with antibodies in buffer in a at and were five in The were incubated with antibodies Jackson for 1 at in a by five muscle cells were with a monoclonal muscle (clone number were in containing and after using a of the was using were under were on a to at and with a The model was into the artery for The was into the aorta and for under light mice were by The aorta was in and into KCl and a vessels were with a to blood of and into rings rings were to in an organ with of and to for as described before T. S. 2001; PubMed Scopus Google Scholar). After an of the rings were to their ± as by the to KCl in M. S. Meyer P. P. 1998; PubMed Scopus Google Scholar). were with to of KCl and to acetylcholine mol/liter) or sodium mol/liter) were In the was by and its was by the of relaxation to acetylcholine In de-endothelialized aortic to KCl obtained with and without of preincubation of the NOS inhibitor methyl and used in this study were from and to in vessels are as of in rings with to about of contraction by reference KCl (100 mmol/liter) for The contractions were expressed as a of reference which were obtained at the beginning of for are as ± In n the number of mice mouse aortic rings were tested and obtained For the of the vessels to the was expressed as the of the that relaxation or contraction relaxation as a of or contraction was determined for by using For between two the test or the test was used For results were by of by S. Circ. Res. PubMed Scopus Google Scholar). were by A of p was Expression of Transgenic hPMCA4b in transgene expression on the RNA level was determined by for a transgene by a vascular the transgenic mouse line used in this study showed ubiquitous expression in tested showing expression only in a of were not used for the protein as determined in Western blotting the transgenic mouse line showed expression in and skeletal this line for on the role of PMCA4b in mechanisms blood In Western a of the transgenic protein was most of different phosphorylation states of the To that the expression of the transgene was to vascular smooth muscle was and of transgene expression to vascular smooth muscles was by with an generated the C of the human PMCA4b and with smooth muscle antibodies of skeletal and expression in vascular smooth muscles and with smooth muscle overexpressing the PMCA4b in vascular smooth muscles showed an in systolic pressure The elevated blood pressure most the tone of the vascular smooth muscles in the PMCA-overexpressing mice. Expression of nNOS and Interaction of nNOS with PMCA4 in test the hypothesis that the in in blood pressure may be of interaction of PMCA4b and NOS as described by (16Schuh K. Uldrijan S. Telkamp M. Rothlein N. Neyses L. J. Cell Biol. 2001; 155: 201-206Crossref PubMed Scopus (134) Google Scholar), we for and interaction of nNOS and PMCA4 in vascular smooth muscle PMCA4 was observed in of various organs. an of wild type aorta with a mouse antibody is shown in nNOS expression in vascular smooth muscle cells was observed in mouse an nNOS expression in control mouse aorta is shown in results showing nNOS expression in vascular smooth muscle cells of Am. J. Physiol. 277: Google Scholar) and it to mouse tissues. interaction of PMCA4 and nNOS was tested by nNOS was by antibodies from wild type and transgenic aorta interaction of in vascular smooth Interaction of nNOS with transgenic hPMCA4b was detected in assays using the human PMCA4b-specific antibody to the and we observed an overexpression of PMCA4b on the protein level in transgenic A of expressed and total PMCA4 is in a relevant level of these results for and interaction of transgenic the PMCA and nNOS in vascular smooth muscle the of PMCA on the regulation of vascular tone, endothelium-dependent and relaxation was in aortic In PMCA4b transgenic endothelium-dependent relaxation to acetylcholine did not differ from wild type littermates (76 ± 8% versus 79 ± 8% for maximum n.s., In nNOS knock-out mice, maximum endothelium-dependent relaxation was compared with control mice, thus of NO on endothelium-dependent relaxation acetylcholine of relaxation was in nNOS knock-out mice and nNOS controls versus n.s., relaxation to the NO sodium was in PMCA transgenic mice and their wild type littermates and in nNOS knock-out mice as compared with their corresponding nNOS controls that the NO production remained in PMCA transgenic and nNOS knock-out mice. to aortic rings of PMCA transgenic mice exhibited increased maximum contraction to KCl as compared with their wild type littermates (86 ± 6% versus 68 ± 7% of reference KCl contraction; p In preincubation of de-endothelialized rings with the NOS inhibitor l-NAME (10–5 mol/liter) resulted in a in contraction to KCl (p versus the corresponding group without l-NAME thus unmasking vasodilatory effects of NO production. Maximum contraction to KCl after preincubation with l-NAME did not differ between PMCA transgenic animals and their wild type littermates ± 7% versus ± 7% of reference KCl which that in PMCA transgenic mice NO production may be In with the results in PMCA transgenic mice, contractions of de-endothelialized aortic rings of nNOS knock-out mice to KCl were significantly elevated compared with their nNOS controls (151 ± 5% versus 131 ± 6% of reference KCl contraction; p thus the vasodilatory role of The present results the into the of the sarcolemmal calcium pump PMCA in the vascular In transgenic mice overexpressing isoform 4b (also of the pump in the we an in blood pressure, endothelium-dependent and increased vascular contraction in to results were by of NO as as in mice. are of of nitric oxide and to regulation of NO synthase I by the PMCA physical interaction of the two Hence, the PMCA is a novel candidate in the of vascular tone. our results may a pump calcium from the be assumed to to smooth muscle relaxation and a in blood The that in calcium regulation an to the regulation of blood pressure has been a of in the of hypothesis states that the sodium across the sarcolemmal membrane plays a role in cellular calcium regulation. in the sodium by an Na+/Ca2+ be as a in intracellular Ca2+ as a in Am. J. Physiol. PubMed Scopus Google Scholar). The importance of the Na+/Ca2+ exchanger has been K. K. A. T. N. S. A. S. Y. K. H. T. S. Y. Shigekawa M. Y. Y. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, T. S. Shigekawa M. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus (84) Google Scholar, Am. J. Physiol. 264: Google Scholar), and a of that smooth muscle calcium not only to contraction but also myosin light chain phosphorylation (reviewed in J. Biol. Chem. 2001; 276: Full Text Full Text PDF PubMed Scopus Google Scholar). overexpression of the sarcolemmal calcium pump PMCA in vascular smooth muscle cells to an in and blood and using experimental we have for our hypothesis that the PMCA is in the regulation of signal transduction than regulation of contraction (12Hammes A. Oberdorf-Maass S. Rother T. Nething K. Gollnick F. Linz K.W. Meyer R. Hu K. Han H. Gaudron P. Ertl G. Hoffmann S. Ganten U. Vetter R. Schuh K. Benkwitz C. Zimmer H.G. Neyses L. Circ. Res. 1998; 83: 877-888Crossref PubMed Scopus (87) Google Scholar). In of our we have shown that the pump is in skeletal muscle A. S. Strehler E.E. T. Carafoli E. Vetter H. Neyses L. J. PubMed Scopus Google Scholar, A. Oberdorf-Maass S. S. T. A. Gollnick F. Meyer R. J. Neyses L. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) and that its overexpression in the of transgenic significantly to but not coupling (12Hammes A. Oberdorf-Maass S. Rother T. Nething K. Gollnick F. Linz K.W. Meyer R. Hu K. Han H. Gaudron P. Ertl G. Hoffmann S. Ganten U. Vetter R. Schuh K. Benkwitz C. Zimmer H.G. Neyses L. Circ. Res. 1998; 83: 877-888Crossref PubMed Scopus (87) Google Scholar). Recently, on the of Strehler and that isoform 4b of the pump a C-terminal to to PDZ protein domains (13Kim E. DeMarco S.J. Marfatia S.M. Chishti A.H. Sheng M. Strehler E.E. J. Biol. Chem. 1998; 273: 1591-1595Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar), we have been to that this isoform to the PDZ of nNOS and regulates it its the activity of the PMCA Ca2+ in the of nNOS and down-regulates its this regulation has in cellular (16Schuh K. Uldrijan S. Telkamp M. Rothlein N. Neyses L. J. Cell Biol. 2001; 155: 201-206Crossref PubMed Scopus (134) Google Scholar). results E. Physiol. PubMed Scopus Google Scholar) an and of skeletal muscle are in line with our The present study this to the that nNOS and PMCA are in vascular smooth muscle Additionally, physical interaction of the two in lysates of aorta was shown In to the wild type NOS by l-NAME had in vessels overexpressing PMCA, in with our in that PMCA down-regulates nNOS activity (16Schuh K. Uldrijan S. Telkamp M. Rothlein N. Neyses L. J. Cell Biol. 2001; 155: 201-206Crossref PubMed Scopus (134) Google Scholar). The specific of PDZ D. H. V. Full Text Full Text PDF PubMed Scopus Google Scholar) and the of interaction with PMCA and isoforms in different remain to be results shown in suggest specific of interaction of with PMCA e.g. phosphorylation (6Neyses L. Reinlib L. Carafoli E. J. Biol. Chem. 1985; 260: 10283-10287Abstract Full Text PDF PubMed Google Scholar, 7Dean W.L. Chen D. Brandt P.C. Vanaman T.C. J. Biol. Chem. 1997; 272: 15113-15119Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 8Wan T.C. Zabe M. Dean W.L. Thromb. Haemostasis. 2003; 89: 122-131Crossref PubMed Scopus (30) Google Scholar) or C-terminal of the PMCA4b A. A. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar), may for different and specific with nNOS C-terminal of as described to in tissues A. A. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar), may also be for the of in (e.g. the antibody was generated the of In we that the sarcolemmal calcium pump is of vascular tone and blood pressure in a animal and we a potential mechanism of regulation of vascular smooth muscle and R. T. G. R. Husain M. Circ. Res. 2003; PubMed Scopus Google Scholar) observed an of blood pressure in an smooth muscle-specific mouse to the of the PMCA and of transgene be to interaction of the pump and to the vascular of PMCA knock-out in the results the sarcolemmal calcium pump in the group of candidate for the of blood are to for this study and D. Parmacek for the SM22α promoter.